Labshake search
Citations for Addgene :
1 - 50 of 134 citations for Corticosterone 17 Deoxycortisol CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Genetics 2022Quote: ... Guides were cloned into SpCas9-2A-GFP (pX458)17 plasmid (Addgene #48138, a gift of Feng Zhang). CRISPR guides used in this study are presented in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequence of mNeonGreen was PCR-amplified from pAc5-V5::mNeonGreen [17] and ligated into the EcoRI-digested pQUAST (#24349, Addgene) vector using In-Fusion ...
-
bioRxiv - Genetics 2021Quote: ... Stable integration of a WT SCN5A into LP-cells was achieved using an optimized SB transposon system (17) using the pSBbi-GN plasmid (a gift from Eric Kowarz, Addgene #60517), which contains SB transposon sequences for genomic integration flanking a promoter upstream of GFP and a second promoter upstream of a multiple cloning site (MCS ...
-
bioRxiv - Cell Biology 2019Quote: ... 11.3 ug of each half library was co-transfected with 17 ug of psPAX2 (Addgene #12260, a gift from Didier Trono) and 11.3 ug of pCMV-VSV-G (addgene #8454 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Genomics 2022Quote: Lentiviral particles were produced by transfecting 293T-17 cells (ATCC: CRL-11268) with the envelope construct pCMV-VSV-G (Addgene plasmid 8454), the packaging construct pCMV-dR8.2 dvpr (Addgene plasmid 8455) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Genetics 2020Quote: Barcoded MSH2-2A-blR cDNA libraries were packaged into lentivirus by co-transfecting HEK293T/17 cells (ATCC) with the transfer plasmid pool plus envelope and packaging vectors (pMD2.G, Addgene #12259 and psPAX2, #12260). For each pool ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We used DNA parts provided with the EMMA cloning kit (Addgene kit # 1000000119) and generated DNA fragments by PCR using Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... including existing parts (Addgene Kit # 1000000080) and custom-made parts (Table 2) ...
-
bioRxiv - Cancer Biology 2023Quote: The one-step multiplex CRISPR-Cas9 assembly system kit was a gift from Takashi Yamamoto (Addgene Kit #1000000055) (2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning (69) ...
-
bioRxiv - Microbiology 2021Quote: ... which was obtained from Addgene (Kit #1000000137). Initially the aph coding sequence in pAJM.011 was replaced by the bla coding sequence ...
-
bioRxiv - Cancer Biology 2019Quote: The CRISPR kit used for constructing multiplex CRISPR/Cas9 vectors was a gift from Takashi Yamamoto (Addgene kit #1000000054). Guide RNAs targeting LRP5 and LRP6 were designed using the Zhang Lab Optimized CRISPR Design Tool (http://crispr.mit.edu) ...
-
bioRxiv - Plant Biology 2022Quote: ... a modular cloning system was employed using MoClo Tool Kit and MoClo Plant Parts kit (Addgene, Supplemental Table S3) (Weber et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... the kit (Golden Gate TALEN and TAL Effector Kit 2.0) consisting of 86 library vectors was ordered from Addgene (www.addgene.org). To assemble the dTALe harboring 16 repeats ...
-
bioRxiv - Plant Biology 2020Quote: ... The following binary plasmids were assembled by Golden Gate cloning using the MoClo Tool Kit for plants (Addgene kit #1000000044) (Weber et al. ...