Labshake search
Citations for Addgene :
1 - 50 of 133 citations for Cholera Toxin Subunit B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Cancer Biology 2019Quote: ... mutant PI3K p110α subunit (pMIG-PI3KE545K, Addgene); Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Cell Biology 2019Quote: ... Histidine-tagged PKA catalytic subunit (a gift from Susan Taylor, Addgene plasmid #14921) and PKI3 were previously described ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or ddGFP-B (Addgene, 40287). cDNAs for the PAR binding domains were amplified from previously published pET19b constructs (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Immunology 2024Quote: ... and B (AUC = 0.61, Addgene) respectively (Fig S10i) ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Neuroscience 2020Quote: ... receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168; http://n2t.net/addgene:49168; RRID: Addgene_49168). Rat GABAAα1 (NM_183326 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Neuroscience 2021Quote: Tetanus toxin light chain (TeTxLC) was amplified by PCR from pGEMTEZ-TeTxLC (Addgene #32640, (Yu et al., 2004)) using forward primer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PDGF-TMD-GFP plasmid (pFU-no toxin-PE) was a gift from Ines Ibanez-Tallon (Addgene plasmid # 24149) 29.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... PMCA2w/b and GCamP6s (both from Addgene); and DsRedExpress2 (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HiFi SpCas9 (#) HypaR-SpCas9 (Addgene #126757), B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Cell Biology 2023Quote: ... and pUC57-b-globin (Addgene plasmid 194437) have been deposited at Addgene.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFPC1-hVAP-B KD/MD (Addgene – 104450), pEFIRES-P-mTagBFP-KDEL (Addgene – 87163 ...
-
bioRxiv - Cell Biology 2019Quote: ... pET-3d plasmid containing Chicken Capping Protein α1 and β1 subunits was a gift from John Cooper (Addgene plasmid #13451) The N-terminal domain of mouse CAP1 in pSUMOck4 was described earlier66.
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Bioengineering 2021Quote: ... and B-GECO was also obtained from Addgene. MaLionG and mitoMaLionR were generated in the author’s group (T ...
-
bioRxiv - Physiology 2022Quote: ... Fabp4-Flex-DTA transgenic construct was generated by inserting the coding sequence of diphtheria toxin A (DTA) into the pBS Fabp4 promoter (5.4kb) polyA vector (Addgene, 11424), flanked by flip-excision (FLEX ...
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and pSH-EFIRES-B-Seipin-miniIAA7-mEGFP (Addgene #129719) [3,10] ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...