Labshake search
Citations for Addgene :
351 - 400 of 2195 citations for C Reactive Protein CRP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... was performed at 50 °C with a mixture of Bsp119I-digested Lenti-Neo-iCas9 (Thermo FD0124; Addgene #85400), dCas9-KRAB-MeCP2-T2A amplicon ...
-
bioRxiv - Physiology 2023Quote: ... plus a five-amino-acid linker plus a C-terminal flag tag was cloned into the pENN.AAV.CB7.CI.pm20d1flag.WPRE.rBG vector (Addgene plasmid no. 132682). AAV8-GFP (pENN.AAV.CB7.CI.eGFP.WPRE.rBG),used as control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRFP with a C-terminal KDEL sequence (ER-mRFP) was PCR amplified out of ER-mRFP (Addgene, 62236) using the forward primer 5’-GGTCGGATCCGCCGCCACCATGGACAGCAAAGG-3’ and the reverse primer 5’-GAGGCACCGGTGTTTAGAGCTCATCTTT-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Cancer Biology 2022Quote: ... 90% confluent HEK29T3 cells in 100 mm plates were transfected with pMD2.G (1.5 μg; Addgene plasmid # 12259), psPAX2 (3.0 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... H9c2 cells seeded in 96 well plates were co-transfected with reporter plasmid and pcDNA3-Mettl3 (Addgene, #53739) (100 ng for each ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK-293T cells seeded into 12 well plates were transfected with the retroviral packaging plasmid pUMVC (Addgene: 8449), pLXIN (Clontech ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biochemistry 2020Quote: ... glycans were released by treatment with 2.0 µL of PNGase F for 20 hr at 37°C (in-house, Addgene #114274 ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were digested with 2.0 µL of PNGase F for 20 h at 37°C (in-house, Addgene #114274 ...
-
bioRxiv - Cancer Biology 2020Quote: ISG15-PA was synthesised in the Kessler lab using the ISG15 C-term (79-156) construct from Addgene (#110760) and DUB ABP assays were performed as previously described69 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminal P2A-EGFP sequence was added to SaABE8e or pCMV-PE2 (Addgene IDs 138500 and 132775, respectively), and the N-terminal BPNLS was added to an SpCas9 plasmid similar to pCMV-T7-SpCas9 (Addgene plasmid ID 139987 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806; http://n2t.net/addgene:79806; RRID: Addgene_79806)66 ...
-
bioRxiv - Cell Biology 2019Quote: ... The h-Fyn gene source was from pRK5-c-Fyn (a gift from Dr. Filippo Giancotti, Addgene plasmid # 16032). Biosensors were constructed using gene fusion ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequence encoding mRuby2 fused to the C-terminus of Paxillin was cloned into the pMSCV retroviral backbone (Addgene). Transduced mRuby2-positive cells were single cell cloned by automated cell deposition unit using a BD FACSAria (BD biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... the specific sybody and the C-terminal MBP were cloned in parallel into the expression vector pBXNPH3M (Addgene #110099) 38–40 using FX cloning 41 ...
-
bioRxiv - Genetics 2020Quote: ... The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237 RRID:Addgene_71237). The guides were inserted into the backbone using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Cell Biology 2020Quote: ... The codon-optimized mCherry sequence with synthetic introns and a C-terminal linker was amplified from pJJR83 (Addgene #75028). Correct amplification and assembly was confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2020Quote: ... After cooling on ice for five min the sample was treated with 5.0 µL of PNGase F for 20 hr at 37 °C (in-house, Addgene #114274 ...
-
bioRxiv - Cell Biology 2021Quote: ... Either a control vector (c-Flag pcDNA3 was a gift from Stephen Smale (Addgene plasmid #20011; http://n2t.net/addgene:20011; RRID:Addgene_20011(47)) ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...