Labshake search
Citations for Addgene :
1 - 50 of 800 citations for BFF 122 CAS 1152314 49 2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 49 (Addgene, 20668) using electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... pFUGW-mCherry-KASH (Addgene #131505,[49]) and pFUGW-spCas9 (Addgene #131506 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pFUGW-spCas9 (Addgene #131506, [49]), pCAGS-PSD95FinR-GFP-TC and pORANGE-empty-FLAG-Cas9 were gifts from Harold MacGillavry ...
-
bioRxiv - Cancer Biology 2020Quote: ... RRID:Addgene_10878)49 and from Stephen Elledge (Addgene plasmid # 44011 ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Neuroscience 2020Quote: ... The (CGG)99 plasmid was obtained from Addgene and the (CTG)202 plasmid was a kind gift from Maurice Swanson ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... RRID:Addgene_10878)49 and from Stephen Elledge (Addgene plasmid # 44011; http://n2t.net/addgene:44011; RRID:Addgene 44011)50 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The pCAG-dGBP1-TagBFP plasmid was a gift from Connie Cepko [49] (Addgene plasmid #80086). Calreticulin overexpression constructs were generated by PCR amplification off of genomic DNA ...
-
bioRxiv - Genetics 2020Quote: The entry vector pENTR221-ZK2 [49] and the destination vector pDEST-APIC-Cas9 (Addgene 121657) were combined in a Gateway LR reaction to generate the expression vector pAPIC2-ZK2-Cas9.
-
bioRxiv - Neuroscience 2023Quote: ... lentivirus was used to stably transduced RPE1 cells with either pLX_311-KRAB-dCas9 49 (Addgene #96918 ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide RNA targeting exon 49 of the MUC2 gene was cloned into the pSPgRNA plasmid (Addgene #47108) using the following oligonucleotide sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... and cloned into vector punc-122::dsRed (coel::RFP Plasmid #8938, Addgene) to generate punc-122::isoform-b::dsRed (6.8 kb) ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ; http://n2t.net/addgene:21474 ; RRID:Addgene_21474 49)) ...
-
bioRxiv - Genetics 2021Quote: ... a 6.6 kb genomic fragment of the nhr-49 gene (including a 4.4 kb coding region covering all nhr-49 transcripts and a 2.2 kb promoter region) was cloned into the GFP expression vector pPD95.77 (Addgene #1495), as reported previously (Ratnappan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... a 6.6 kb genomic fragment of nhr-49 gene (comprising of 4.4 kb coding region covering all nhr-49 transcripts plus 2.2 kb sequence upstream of ATG) was cloned into the GFP expression vector pPD95.77 (Addgene #1495), as reported previously (Ratnappan et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Microbiology 2024Quote: A doxycycline-inducible CRISPR/Cas9 expression vector (pSBtet-puro-Cas9-U6) was generated by cloning the Cas9-U6 portion of pX459 (Addgene #62988; [49] into pSBtet-pur (Addgene #60507; [50]). Cas9 was first cloned into pSBtet-pur using the following primers ...
-
bioRxiv - Genomics 2022Quote: sgRNA targeting the genomic region of integration was cloned in BbsI linearized pX335-U6-Chimeric_BB-CBh-hSpCas9n (99) (D10A) plasmid (Addgene #42335) using NEBuilder HiFi DNA Assembly Master Mix (1:3 molar ratio ...
-
bioRxiv - Biochemistry 2023Quote: Dephosphorylated AurA (residues 122-403, TEV-cleavable, N-terminal His6-tagged, kanamycin-resistance) in pET28a and LPP (#79748) from Addgene were cotransformed in BL21(DE3 ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding CGI-99 (Uniprot Q9Y224) was cloned into site 1 of the UC Berkeley MacroLab 5A vector (gift from Scott Gradia, Addgene plasmid #30121), while DNA sequence encoding FAM98B (Uniprot Q52LJ0 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: Wild-type or SURF4-deficient HEK293T cells that stably express EPO-eGFP and A1AT-mCherry were transfected with a plasmid expressing ERoxBFP (Addgene: 68126, a gift from Erik Snapp (99)) ...
-
bioRxiv - Cancer Biology 2022Quote: Retroviral pLPCX vectors expressing the mitochondrial or cytoplasmic form of Grx1-roGFP227 and roGFP2-ORP123 were obtained from Addgene (Addgene, Watertwon, CA, USA) and used to transduce FL5.12MycER cells ...
-
bioRxiv - Cancer Biology 2024Quote: pLEX304mNeonGreen (Addgene; CA#162034)
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and FUCCI(CA) (Addgene, 153521). For EB3:tdStayGold ...
-
bioRxiv - Cancer Biology 2024Quote: pLBS-mScarlet (Addgene; CA#129337)
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pCW57.1-mDux-CA (Addgene, 99284) plasmids were used for lentivirus production.
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...