Labshake search
Citations for Addgene :
101 - 150 of 1833 citations for B Cell Activating Factor BAFF TNFSF13B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Microbiology 2021Quote: The plasmids coding GeCKO sub-libraries A and B were amplified and prepared according to the provided guidelines (Lentiviral Crispr Toolbox, Addgene). 60 million T98G/Cas9 cells were transduced with GeCKO LVs at a MOI of 0,1 to cover about 100-times the half-library complexity ...
-
bioRxiv - Cell Biology 2021Quote: ... and non-targeted Suv420-GFP was achieved by cloning the respective cDNA into Addgene vector CENP-B DBD INCENP GFP (45237, Addgene) at NheI / BamH1 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Biochemistry 2023Quote: E.coli codon optimized gBlocks encoding CAHS D and its mutant proteins used in this study were synthesized by (Integrated DNA Technologies) and cloned into pET-28 b (+) vector (Addgene) for bacterial expression ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Neuroscience 2020Quote: For retrograde tracing followed by STARmap (Fig. 6A, B) we injected 150 nL of AAVretro-Ef1a-FlpO (Salk vector core, Addgene #55637) or AAVretro-Ef1a-Cre (Salk vector core ...
-
bioRxiv - Biochemistry 2020Quote: Human ATAD2/B cDNA (UniProt codes Q9ULIO and Q6PL18) was a gift from Nicole Burgess-Brown (Addgene plasmid # 38916 and 39046)7 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Immunology 2022Quote: ... were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene, Cat#1000000049), and subsequently selected using 2 µg/mL puromycin (Calbiochem ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Systems Biology 2022Quote: ... and added undiluted to K562 cells for a final cell concentration of 3-4 x 105 cells/mL for pJT126-based effector recruitment vectors (Addgene #161926) or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Knockout cells generated in 293A and HeLa cells were created with pLentiCRISPRv2 (Addgene, #52961) containing indicated gRNAs (Figure 7-figure supplement 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T cells (#240073, Addgene, USA) were used for viral production ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent cells were prepared from frozen cell stocks and transformed with the pFREE vector (Addgene plasmid #92050 ...
-
bioRxiv - Cell Biology 2019Quote: Stable Cas9-expressing cells were generated by transducing BeWo cells with lentiCAS9-blast (Addgene, cat. 52962). To generate TMEM16F/ANO6 knockout cells ...
-
bioRxiv - Systems Biology 2020Quote: ... MDCKI + bPAC cells were generated by infecting MDCKI cells with pLenti-PGK-bPAC::NES (Addgene #130267). PKAc expressing cells were obtained by transfecting MDCKI and MDCKI + bPAC cells with pPB-CAG-PRKACA::mRuby2 (Addgene #130268) ...
-
bioRxiv - Cell Biology 2019Quote: For generation of lentiviral knockout and overexpression cells HEK293T cells were transfected with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2022Quote: ... KMS11-Cas9+ cells and LP1-Cas9+ cells (transduced with pLX 311-Cas9 construct, Addgene plasmid # 96924) were obtained from the Broad Institute ...
-
bioRxiv - Immunology 2024Quote: ... VDJ sequences were ordered from IDT and cloned into the vector AbVec antibodies (Addgene)
-
bioRxiv - Genomics 2022Quote: ... and NIH/3T3 cells (Addgene #138149), as well as doxycycline-inducible nuclease-inactive RfxdCas13d-NLS HEK293FT ...
-
bioRxiv - Microbiology 2020Quote: ... and AdEasier-1 cells (Addgene #16399) were a gift from Bert Vogelstein (He et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells harboring plasmid pKM208 (Addgene #13077) were cultured at 30°C to an O.D ...
-
bioRxiv - Microbiology 2023Quote: ... Electrocompetent cells containing pREDCas9 (Addgene #71541) were generated as previously described[68] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli MG1655 K12 cells (Addgene #37854) transformed with reporter ...
-
bioRxiv - Immunology 2023Quote: ... Phoenix-Eco cells (Addgene CRL-3214) were used for retrovirus production ...
-
bioRxiv - Cell Biology 2020Quote: ... endogenous SETD2 was immunoprecipitated using whole-cell extracts from HEK293T cells expressing mCherry-ACTB (Addgene plasmid #54966). Similarly ...
-
bioRxiv - Microbiology 2023Quote: ... IMR90 MxB KO cells were constructed by transducing the cells with lentiviral vector (lentiCRISPR v2; Addgene #52961) containing a gRNA targeting the genomic MxB target sequence (5’-GGTGGTGGTTCCCTGTAACG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... untransfected HEK293T cells or cells transfected 48 hours earlier with pEGFP-C1 Lifeact-EGFP (Addgene, plasmid #58470) were treated with Wnt5a CM or protein (200 ng/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... MDA-MB-231 cells and NCI-H1299 cells were infected with pLentiCRISPR V2 viral vector (Addgene, # 52961) in which the sgRNA for human MPC1 gene (5’-AAGTCTCCAGAGATTATCAG-3’ ...
-
bioRxiv - Microbiology 2021Quote: Stable ACE2 expressing HeLa cells (HeLa-ACE2) were generated by transducing HeLa-dCas cells with pLENTI_hACE2_HygR (Addgene, #155296) followed selection with hygromycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells stably expressing dCas9-KRAB were generated by transducing LNCaP cells with Lenti-dCas9-KRAB (Addgene #89567) followed by blasticidin selection ...
-
bioRxiv - Molecular Biology 2019Quote: Inducible Cas9 (iCas9) BL cells were established by transducing cells with pCW-Cas9-Blast-based lentiviruses (Addgene #83481) and selecting with Blasticidin ...
-
bioRxiv - Cell Biology 2020Quote: ... Vector control cells were created by transfecting C2C12 cells with an empty pBABE-puro vector backbone (#1764, Addgene) and selected and kept in culture medium with 10 μg/mL puromycin.