Labshake search
Citations for Addgene :
1 - 50 of 90 citations for Anti Cathepsin D HC Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and MYC (pMXs-hc-MYC Addgene: 17220) and subsequently frozen after a quality control which included (a ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald Hc-SRC-N-18 (Src-eGFP here) was a gift from Michael Davidson (Addgene plasmid # 54118 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Knockout HIC1 HC cell lines (HIC1 KO) were generated using the lentiCRISPRv2 vector (Addgene, #52961); HIC1-specific single guide RNA (sgRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen-inducible Rosa26::CreERT2 embryo and immortalized by transduction of pMXs-hc-MYC (Addgene 17220) followed by limiting dilution and clone derivation (see “iMEF B” in ref ...
-
bioRxiv - Synthetic Biology 2023Quote: ... D-sup (Addgene #90019) and DMC1 (CRG ORFome collection ...
-
bioRxiv - Genetics 2022Quote: ... pENTR/D-CreERT2 (Addgene#27231)(Mosimann et al. ...
-
bioRxiv - Microbiology 2019Quote: ... The pUPRT::DHFR-D (Addgene, Cat#58528) plasmid backbone with PCR-amplification to remove the DHFR cassette was used to generate the construct for making the GRA45 complementation ...
-
bioRxiv - Cell Biology 2022Quote: ... and PJ-DEAD (PJ-D) (Addgene plasmid # 38002) were gifts from Robin Irvine ...
-
bioRxiv - Synthetic Biology 2023Quote: ... psPAX2 (Addgene plasmid #12260, a gift from D. Trono), and pCMV-VSV-G-RSV-Rev (RIKEN BioResource Research Center plasmid RDB04393 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-pLKO-puro (gift from D. Wiederschain, Addgene plasmid # 21915) was digested with AgeI and EcoRI and isolated by gel purification (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... vector eGFP-pWPT (Addgene #12255, kind gift from D. Trono) was used to express eGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... packaging with psPAX2 (gift of D. Trono; Addgene plasmid #12260) and pseudo typed with pMD2.G (gift of D ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µg psPAX2 (a gift from D. Trono, Addgene #12260), and 0.7 µg pMD2.G (a gift from D ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: An HBV genotype D subtype ayw replicon (62) was obtained from Addgene. HBV Ae (genotype A) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.7 µg pMD2.G (a gift from D. Trono, Addgene #12259), mixed with 9 µL lipofectamine 2000 transfection reagent in 2 mL Opti-MEM-I medium ...
-
bioRxiv - Microbiology 2023Quote: ... respectively and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575 ...
-
bioRxiv - Cancer Biology 2021Quote: ... plus pSPAX2 and pMD2.G (gifts from D. Trono; Addgene #12260 and #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pseudo typed with pMD2.G (gift of D. Trono; Addgene plasmid #12259). Following transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... sechellia UAS-SPARC2-D-CsChrimson: we digested a SPARC2-backbone vector (Addgene #133562) with SalI and inserted a CsChrimson-Venus cassette after PCR amplification from pBac(UAS-ChR2 CsChrimson,3xP3::dsRed ...
-
bioRxiv - Cell Biology 2022Quote: ... OMP25 was PCR amplified from paGFP-Omp25 (gift from D. Sabatini, Addgene plasmid #69598) and cloned with XhoI/BamHI into mMaple-C1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... were co-transfected with plasmids pMD2.G (provided by D. Trono; Addgene no. 12259) and pCMV-deltaR8.91 (Lifescience market) ...
-
bioRxiv - Immunology 2023Quote: ... BTN3A1 or control BTNL3 in pMIG (a gift from D. Vignali (Addgene plasmid # 52107) 31 using ViaFect® (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... TOPO-cloned the PCR products into pENTR-D-TOPO and transferred to pBPGUw (Addgene #17575) using standard Gateway cloning ...
-
bioRxiv - Cancer Biology 2020Quote: ... together with the packaging plasmid psPAX2 (a gift from Dr. D. Trono, Addgene plasmid #12260), and pCMV-VSV-G-RSV-Rev (a gift of Dr ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.75 μg of psPAX2 and 0.25 μg of pMDL.g (gifts from D. Trono, Addgene #12260, #12259). At 36 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.75 μg of psPAX2 and 0.25 μg of pMD2.g (gifts from D. Trono, Addgene #12260, #12259). At 36 hrs post transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575; http://n2t.net/addgene:26575; RRID: Addgene_26575) 77 ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 2016) (Fig. 5A, Suppl. Figs. 3C,D and 8; Salk Vector Core; 1.0 x 1012; Addgene plasmid #55636); AAV1-SynP-DIO-splitTVA-EGFP-B19G (Fig ...
-
bioRxiv - Microbiology 2023Quote: The construct for GRA47 complementation was created using the pUPRT::DHFR-D plasmid backbone from Addgene (Cat#58528). The DHFR cassette was eliminated through PCR amplification using primers pUPRT::GOI GIB F and pUPRT::GOI GIB R (Table S1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2021Quote: ... All the sgRNAs were designed using Benchling Life Sciences R&D Cloud Software (https://benchling.com/) and cloned into the pSpCas9(BB)puroV2.0 vector (Addgene #62988), which expresses both Cas9 and puromycin resistance genes23,24 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Hammer (National Institutes of Health) (63)) and jRGECO1a (pAAV.Syn.NES-jRGECO1a.WPRE.SV40, kind gift from D. Kim & GENIE Project, Addgene plasmid #100854, (29)) ...
-
bioRxiv - Neuroscience 2021Quote: ... EnvA-Rab-CVS-N2cΔG-EGFP (Fig. 5A and Suppl. Fig. 3C,D; Columbia Vector Core; 1.0 x 109; Addgene plasmid #73461); EnvA-Rab-pSADΔG-mCherry (Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... 5B and Suppl. Fig. 8B-D; UNC Vector Core; 4.0 x 1012 and Penn Vector Core; 4.25 x 1012; Addgene plasmid #20298); AAV1-EF1a-DIO-hChR2(H134R)-mCherry (Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression vectors for NFAT4 D-site variants were prepared by subcloning residues 3 – 407 of WT NFAT4 from the corresponding mammalian expression vector (Addgene #21664) into pGEX4T1 ...
-
bioRxiv - Cell Biology 2022Quote: ... was a gift from Sean Munro (MRC Laboratory of Molecular Biology). The CENPB-mCh plasmid (D. Liu et al., 2010) was generated by Michael Lampson and obtained from Addgene (#45219).
-
bioRxiv - Molecular Biology 2022Quote: ... pXR003 processed gRNA was cloned into pKLV2.3-Hygro mCherry gRNA lentiviral plasmid (33) using EcoRI and Mlu and amplying (d)CasRx directed repeats from pXR003 processed gRNA (Addgene #109053) using the following F (CCCACGCGTGAGGGCCTATTTCCCATGATTC ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... ±2.25, D/V: −3.10 (100 nl/injection, 25 nl/min infusion rate) and AAVrg-Ef1a-mCherry-IRES-Cre (Addgene, 55632-AAVrg) in the DLS at coordinates A/P ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA FB-SNAP and anti-HA FB-Halo (Addgene #129592), cut by EcoRI and combined with anti-FLAG frankenbody gblocks by Gibson assembly ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...