Labshake search
Citations for Addgene :
1 - 50 of 55 citations for Ammonium Polyphosphate phase II 02 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... pAK-EL-02 (Addgene ID #125761) and pFH66 (Addgene ID #131765 ...
-
bioRxiv - Cell Biology 2023Quote: ... a human colon line (HUB-02-A2-040) was lentivirally transduced with pGK Dest H2B-miRFP670 (Addgene). Lentiviral transduction was performed on single cells after 0.05% Trypsin EDTA (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.02 U/μL Q5 high-fidelity DNA polymerase and 0.25 ng/μL of pScaffold-H1 vector (plasmid #118152, Addgene), with Ta = 58°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The split-GAL4 donor plasmids with appropriate splicing phases were obtained from Addgene, including pBS-KS-attB2-SA(0)-T2A-GAL4DBD-Hsp70 (Addgene #62902) ...
-
bioRxiv - Microbiology 2021Quote: ... the pBluescript II KS(+) (Addgene) was utilized ...
-
bioRxiv - Neuroscience 2020Quote: ... and of (ii) GluA2 (Addgene #24001) by replacing the corresponding pHluorin cDNA within these Addgene clones ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG-Pol-II WT and FLAG-Pol-II-Δ (entire CTD deleted) were gifts from Benjamin Blencowe (Addgene plasmids # 35175 and # 35176 respectively) ...
-
bioRxiv - Developmental Biology 2021Quote: ... or pIRES-hrGFP II-mTET1 (Addgene #83569), and cloned into the NotI digested PCDH-CAG-MCS-P2A-Puro vector (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAF-II cells stably expressing FUCas9Cherry (Addgene#70182) were transduced with MSMO1 sg RNA or FAXDC2 sgRNA along with pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Cancer Biology 2023Quote: ... (ii) HEK293T with 1.3 μg of psPAX2 (Addgene, #12260), 0.8 μg of pVSVG (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... Both insert and the Ii-Str_TNF-SBP-EGFP (#65280, Addgene) vector were digested using AscI and SbfI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: The PI4P sensor based on optically-controlled phase separation was created by fusion of P4M domian from mCherry-P4M-SidM (#51471, Addgene, USA) to mGFP-CIBN ...
-
bioRxiv - Cell Biology 2020Quote: ... into the XhoI site of pBluescript II SK+ (Addgene, Watertown, MA) to create the plasmid pEcoRI_ASalxh.pBSKS.rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2021Quote: Nos regulator elements drive the myosin II RLC (Eric Wieschaus56, Addgene 20163) fused to tdTomato (Michael Davidson ...
-
bioRxiv - Bioengineering 2020Quote: ... or pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) containing the CRMpMHCIIα constructs ...
-
bioRxiv - Plant Biology 2023Quote: ... A neomycin phosphotransferase II (NPTII) cassette (pICH47732::NOSp::NPTII, Addgene no. 51144) was used as selectable marker for plant transformation ...
-
bioRxiv - Cell Biology 2024Quote: ... We purchased the plasmid expressing an ER-localized hook protein from Addgene (Ii-Str_Neomycin; #65308). To generate various model substates with artificial CAT-tails ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HS-SY-II and SYO1 synovial sarcoma cell lines were transduced with lentiCas9-Blast85 (Addgene, #52962) and selected using 20 μg/ml of blasticidin to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... This fragment was then inserted into the pLenti-mCherry-Mango II x 24 plasmid (Addgene #127587) digested with Nhe I and BamH I ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... An AAV9 expressing GCaMP6f under a CaM Kinase II promoter (pENN.AAV9.CamKII.GCamp6f.WPRE.SV40, titer ≥ 1×10¹³ vg/mL, Addgene) was then injected bilaterally into the medial prefrontal cortex (mPFC) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 75 ng ER_GFP-SBP-AG10 and either 225 ng Ii-Str_Neomycin (A gift from F. Perez, Addgene plasmid #65308; http://n2t.net/addgene:65308; RRID:Addgene_65308) or EV using Invitrogen Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... Fragments were purified by agarose gel electrophoresis and individually subcloned into BamHI/NotI-digested pBluescript II KS+ (Addgene). Colonies positive for the plasmid were selected on LB agar with 100 μg/ml ampicillin (Gibco from Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 75 ng ER_GFP-SBP-AG10 and either 225 ng Ii-Str_Neomycin (A gift from F. Perez, Addgene plasmid #65308 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+) (Addgene, 212205) by restriction-enzyme based cloning and the cHS4-CAG-nlstdTomato-cHS4 and cHS4-CAG-nlsGFP-cHS4constructs ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Genetics 2020Quote: ... Gibson assembly was used to clone the Vasa-β-globin-II fragment from the Vasa-Cre plasmid (Addgene; 15885) (Gallardo et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... Mayo Clinic) and 10 μg of TCR-2A-OTI-pMIG-II DNA (gift from Dr. Dario Vignali, Addgene #52111) as described above ...
-
bioRxiv - Neuroscience 2020Quote: βII-spectrin-ΔCH-GFP and βII-spectrin-ΔPH-GFP plasmids were modified from FUGW-GFP plasmid (Addgene, 14883, Cambridge, MA). In details ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sense and antisense riboprobes were designed by subcloning fragments of coding cDNA sequences in pBlueScript II (SK or KS) plasmids (Addgene). Riboprobes were generated by in vitro transcription using the SP6/T7 DIG RNA labelling kit (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: ... attP40{nos-Cas9}/CyO which carries a recessive lethal allele on the second chromosome and cannot be made homozygous) or (ii) a line we generated that has nos-Cas9 (from Addgene plasmid 62208 courtesy of Simon Bullock which has a single NLS and a 3’UTR from nanos ...
-
bioRxiv - Immunology 2023Quote: ... Myc overexpression was achieved using the Nucleofector™ II/2b (Amaxa, Koelin, Germany) with pMXs-cMyc plasmid (Addgene plasmids #13375). Naive CD4+ T cells were resuspended in 100μl nucleofector solution (Amaxa ...
-
bioRxiv - Plant Biology 2024Quote: ... The amplified genes harboring the V5 sequence were cloned with BP clonase II in pDONR221 and then recombined into the destination vector pAG425GPD-ccdB (Alberti et al., 2007)(Addgene plasmid #14154 was a gift from Susan Lindquist ...
-
bioRxiv - Genomics 2024Quote: ... 20Q1 Cancer Dependency Map common essential genes (https://depmap.org/portal/download/) and (ii) 5% non-targeting control sgRNAs cloned into pJR101 (Addgene #187241). A second sgRNA library (dJR092 ...
-
bioRxiv - Plant Biology 2024Quote: ... The open reading frames harboring the V5 sequence and Gateway compatible attB1 and attB2 recombination sites were cloned with BP clonase II in pDONR221 and then recombined into the destination vector pAG426GPD-ccdB (82) (Addgene plasmid #14156 was a gift from Susan Lindquist ...
-
bioRxiv - Cell Biology 2024Quote: ... scrambled and W-mut constructs for RUSH experiments were generated by amplifying ER hook from Str-ii vector (65300 - Addgene) and SBP-LiveDrop RUSH construct from a geneBlock (IDT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then LR clonase II reactions were used to shuttle ORFs into pCW-DEST (lentiviral Dox-inducible expression) derived from pCW-Cas9 (Addgene # 50661), and pmax-DEST (transient constitutive expression ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Molecular Biology 2022Quote: ... and ΔC (251-545 aa) truncation domains were PCR amplified and cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). The genes encoding Csb1/I-G ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...