Labshake search
Citations for Addgene :
501 - 550 of 3276 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... All constructs were separately packed into lentiviral particles using pdelta8.9 (Addgene, #2221) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2022Quote: ... where 140 nL of AAVretro-tdTomato (stock 1.02*1013 particles/nL, Addgene) was injected at 300 μm below the pia ...
-
bioRxiv - Cancer Biology 2019Quote: ... A375 cells were transduced with lentiviral particles produced using vector pMH0001 (Addgene #85969 ...
-
bioRxiv - Cancer Biology 2020Quote: ... we produced lentiviral particles from pHAGE EF1α dCas9-KRAB (Addgene plasmid # 50919) or pHAGE TRE dCas9-KRAB (Addgene plasmid # 50917 ...
-
bioRxiv - Biochemistry 2022Quote: ... U2OS cells were transduced with lentiviral particles prepared with pCVL.TrafficLightReporter.Ef1a.Puro (Addgene #31482) at a low multiplicity of infection and selected with 2 μg/ml puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... we produced lentiviral particles from pHAGE EF1α-dCas9-KRAB (Addgene plasmid #50919) using Pax2 and VSVg ...
-
bioRxiv - Cancer Biology 2023Quote: ... K562 cells were transduced with lentiviral particles produced using vector pMH0001 (Addgene #85969 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were infected with pHIV-Luc-ZsGreen viral particles (Addgene plasmid # 39196), FACS sorted for ZsGreen expression and used for in vivo experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral particles were generated by co-transfection with pMDLg/RRE (Addgene #12251) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Plant Biology 2019Quote: ... Green fluorescent protein (GFP) from the Gateway entry vector pENTR4-GFP-C1 (Addgene) was transferred to pYES-DEST52 and pAG426GAL-ccdb using Gateway LR Clonase ...
-
bioRxiv - Cell Biology 2022Quote: Kinesin-1-GFP: Plasmid coding for kinesin-1-GFP was purchased from Addgene repository (#129761) ...
-
bioRxiv - Cell Biology 2021Quote: The plasmids FUG-T2A-GFP-Cre and control GFP were purchased from Addgene #66691 and lentiviral particles were produced in HEK-293T cells using X-tremeGene 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Bioengineering 2022Quote: ... was generated by transferring a GFP coding sequence from pALB-GFP (Addgene #55759) into pENTR4 (Addgene #17424 ...
-
bioRxiv - Cell Biology 2022Quote: ... was prepared by transferring a GFP-coding sequence from pALB-GFP (Addgene #55759) into pENTR4 (Addgene #17424) ...
-
bioRxiv - Developmental Biology 2020Quote: H2B-GFP line was generated by nucleofecting the H2B-GFP plasmid (Addgene #11680) into the A17 E14Tg2a line ...
-
bioRxiv - Molecular Biology 2022Quote: An experiment uses rAAV vectors expressing GFP (pAAV-CAG-GFP (Addgene Cat# 37825)) or TdTomato (pAAV-CAG-TdTomato (Addgene Cat# 59462) ...
-
bioRxiv - Bioengineering 2023Quote: ... GFP-labelled cells were generated by infecting them with GFP lentivirus (Addgene 17448).
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with GFP-RhoA-AHPH (AKA GFP-RhoBio) (Addgene Plasmid #68026)(15 ...
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligo nucleotides containing CRISPR target sequences (5’-CCGGCCGGGCCTACGGCTTG-3’) were annealed and ligated into pSpCas9 (BB)-2A-GFP (PX458) (Addgene 48138). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCAAGATGATCCCAATGAGT) or Ifngr2-targeting sgRNAs (3’-gRNA-‘5: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene #48138) or px459-pSpCas9(BB)-2A-Puro (Addgene #62988) ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Systems Biology 2021Quote: ... and pAdTrack-CMV FLAG Rev-erbα expression vectors (a gift from Bert Vogelstein; Addgene plasmid #16405) for ectopic expression of Cry1 and Rev-erbα ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... Control animals were injected with a control virus (pAAV-CMV-PI-eGFP-WPRE-bGH; Addgene; #105530). For both experiments ...
-
bioRxiv - Bioengineering 2022Quote: ... IDT gBlocks encoding fragments of dPspCas13b as in pC0039-CMV-dPspCas13b-GS-ADAR2DD(E488Q) (Addgene# 103849) (25 ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
bioRxiv - Molecular Biology 2020Quote: ... lentivirus destination vector or into the pLenti CMV Puro DEST (w118-1) vector (Addgene Plasmid #17452) using Gateway LR Clonase (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Plenti-CMV-MCS-RFP-SV-puro was a gift from Jonathan Garlick & Behzad Gerami-Naini (Addgene plasmid # 109377 ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pLenti CMV rtTA3 Blast (w756-1) was a gift from Eric Campeau (Addgene plasmid #26429).
-
bioRxiv - Pathology 2021Quote: The constitutively activated STAT3 plasmids (STAT3-C Flag pRc/CMV) were purchased from Addgene (Plasmid #8722). C2C12 cells were transiently transfected with STAT3-C plasmids using the Lipofectamine™ 2000 Transfection Reagent according to the manufacturer’s instructions (Life Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pINDUCER20 (Meerbrey et al., 2011) and pLenti CMV Blast DEST (706-1) (Addgene plasmid #17451 was a gift from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNAs were transferred into gateway-compatible lentiviral expression vectors pLX304 (Addgene, #25890, CMV promoter driven expresion) or pRRL (described previously52 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PE2 sequence including the backbone corresponds to the previously published CMV-PE2 construct (Anzalone) (Addgene #132775). To generate PEn ...
-
bioRxiv - Systems Biology 2021Quote: ... Three gRNA vectors were constructed in the dual U6-gRNA/CMV-Cas9 expression vector pX330 (Addgene) based upon predicted high scoring guides from CRISPOR.tefor.net ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Blast DEST (706-1) (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17451)) constructs carrying a human Plxdc1-TwinStrep or Plxdc2-TwinStrep expression cassette (pLenti-CMV-Blast-Plxdc1-Strep/ pLenti-CMV-Blast-Plxdc2-Strep ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-retro-CMV-EGFP (Suppl. Fig. 8A; Salk Vector Core; 3.7 x 1012; Addgene plasmid #32395); AAV1-EF1a-DIO-hChR2(H134R)-EYFP (Fig ...
-
bioRxiv - Cell Biology 2020Quote: ... and then sub-cloned into pLenti-CMV/TO-DEST (gift from E. Campeau, Addgene plasmid #17291) (Campeau et al. ...
-
bioRxiv - Microbiology 2020Quote: ... CMV-SEAP was a gift from Alan Cochrane (Addgene plasmid #24595; http://n2t.net/addgene:24595; RRID:Addgene_24595). The CMV-SEAP-T7 construct was made based on plasmid CMV-SEAP with the addition of six glycine linkers and the T7 tag at the C-terminus ...
-
bioRxiv - Cell Biology 2022Quote: ... The CMV immediate-early promoter described the pCRE-iRFP670 was a gift from Alan Mullen (Addgene plasmid # 82696 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral construct was generated via recombination of pENTR1A-Breg into pLenti CMV/TO Puro DEST (Addgene), and lentiviruses were produced by co-transfection along with plasmids pLP1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The PA-mCherry sequence was cloned into pShuttle-CMV plasmid (gift from Dr. Bert Vogelstein – Addgene plasmid # 16403 ...
-
bioRxiv - Neuroscience 2022Quote: [7] GCaMP6s from pGP-CMV-GCaMP6s (a gift from Douglas Kim & GENIE Project, Addgene ID # 40753) (Chen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Entry vectors were transferred into pDEST-CMV-N-EGFP (24) (Prof. Robin Ketteler, AddGene clone 122842) and/or pdcDNA-FlagMyc (B ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Microbiology 2023Quote: ... constructed with pCMV-VSV-G)(110), p5349 (pBS-CMV-gagpol, a gift from Patrick Salmon (Addgene plasmid # 35614 ...