Labshake search
Citations for Addgene :
201 - 250 of 1633 citations for ADAM Metallopeptidase With Thrombospondin Type 1 Motif 6 ADAMTS6 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... A cDNA for GFP-tagged mouse septin 6 was obtained from Addgene (plasmid #38296) and cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Developmental Biology 2020Quote: ... To generate CRISPR Cas9 knockout mESC lines we transfected wild-type (for Srpk1 and Srpk2) or Rlim-/y (for Zfp42) mESCs with pX335 and pKN7 vectors (Addgene) containing gRNA sequences targeting ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... This construct was generated from a plasmid that contained a wild-type (WT) rat Nfasc gene expressed from the cytomegalovirus (CMV) promoter (a gift from Vann Bennett, Addgene plasmid # 31061 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293Ts were made to stably express doxycycline(dox)-inducible wild-type muSOX and its catalytically-dead D219A mutant by PCR amplifying the aforementioned coding sequences from Addgene plasmids 131702 and 131704 using the muSOX F/R primers (see Key Resources Table ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HDR donor plasmids carrying wild type me31B gene were constructed by cloning me31B gene DNA into pHD-sfGFP-ScarlessDsRed cloning vector (Addgene) according to suggested protocols ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal 109 residues from wild-type TnsB (termed hereafter as TnsBCTD) was cloned from pXT129_TwinStrep-SUMO-ShTnsB vector (Addgene, #135525) using Q5 site-directed mutagenesis kit (NEB ...
-
bioRxiv - Immunology 2023Quote: DNA inserts containing the coding DNA sequence (CDS) for each wild type gene were generated by restriction digestion previous amplification from plasmids obtained from Addgene (hMX1 ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Biochemistry 2020Quote: HEK293T CRISPR-Cas9 cells were generated by transfecting wild-type 293T cells with pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Plasmid# 42230) carrying single-guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6 mice were injected with the AAV5-CAG-ChR2-mCherry adenovirus (200 nL, Addgene) in the PC ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Neuroscience 2022Quote: [6] 15xQUAS from BAC-ECFP-15xQUAS_TATA-SV40 (a gift from Christopher Potter, Addgene ID #104875) (Riabinina et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: The Tau/pET29b plasmid used for wild type FLTau (2N4R) expression and purification was a gift from Peter Klein (Addgene plasmid #1631683).
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pDsRed-RAB11A WT (for expression of a fluorescently-tagged, wild-type version of RAB11A in human cells) was obtained from Addgene (plasmid 12679). For expression of GFP-HEATR5B from baculovirus ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Cell Biology 2020Quote: ... Venus-iLID-CAAX (from KRas4B) and pLL7.0: tgRFPt-SSPB wild-type (WT) (19) were gifts from Brian Kuhlman (Addgene plasmid #60411 and #60415). PR_GEF (2XPDZ-mCherry-Larg (DH) ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... were obtained by transducing wild type HCT116 colorectal carcinoma cell line (ATCC® CCL-247™) with lentiCas9-Blast lentiviral vector (Addgene #52962). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... The TFEB wild-type (WT-TFEB [plasmid #38119]) and mutant (Δ30-TFEB [plasmid #44445]) constructs were obtained from Addgene (deposited by Shawn Ferguson) and transfected into H1HeLa using the Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Biochemistry 2020Quote: Human cDNAs of wild-type TAZ and mutants containing deletions of the WW or CC domains (gifts from Dr. Jeff Wrana: Addgene #24809, #24811, and #24816) were cloned into a pcDNA3-FLAG vector by PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...