Labshake search
Citations for Addgene :
51 - 100 of 2940 citations for 8H Pyrrolo 2 3 g benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... VSV-G (pMD2.G, Addgene Plasmid #12259) in 1:1:1 molar ratio) ...
-
bioRxiv - Neuroscience 2023Quote: ... and VSV-G (pMD2.G, Addgene, #12259). Cells were seeded in a 15 cm dish in 22.5 ml media (DMEM with 4.5g/l glucose and pyruvate ...
-
bioRxiv - Microbiology 2023Quote: ... VSV-G plasmid (pMD2.G Addgene 12259), and pCMV delta R8.2 (Addgene 12263) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Microbiology 2023Quote: ... a vesicular stomatitis virus G (VSV-G) envelope expression vector (pMD2.G, #12259, Addgene) and a lentiviral transfer vector containing the transgene in a ratio of 2:1:3 by calcium phosphate transfection ...
-
bioRxiv - Cancer Biology 2019Quote: ... pMD2.G (VSV-G envelope plasmid; Addgene#12259), pLVTHM-GFP (Addgene#12247) ...
-
bioRxiv - Cancer Biology 2021Quote: ... envelope plasmid pMD2.G (VSV-G) (RRID: Addgene_12259) and Tet-pLKO-puro all-in-one vectors harboring shRNAs against RRM2 (shRRM2 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 μg of pMD2.G (VSV-G, Addgene), and 1.7 μg of the pLVX-TetOne-Puro vector encoding the APOBEC proteins ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and VSV-G (pMD2.G; Addgene cat. 12259). ATF6 and NRF2 shRNAs in pLKO.1 vectors were obtained from La Jolla Institute for Allergy and Immunology (LJI) ...
-
bioRxiv - Cell Biology 2023Quote: ... and VSV-G (pMD2. G; Addgene cat. 12259). Mission shRNA plasmids in pLKO.1 vectors were obtained from La Jolla Institute for Allergy and Immunology (LJI ...
-
bioRxiv - Microbiology 2023Quote: ... pMD2-G VSV-G envelope plasmid (Addgene, #12259), Blast-Cas9 plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig. 2F,G and Supplementary Movie 3; Vigene Biosciences; 2.5 x 1012; Addgene plasmid #105677); AAV1-hSyn-DIO-TVA66T-tdTomato-CVS-N2cG (Fig ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... and 0.25 μg VSV-G (pMD2.G, Addgene, 12259) using 3 μL Polyjet (SignaGen ...
-
bioRxiv - Neuroscience 2023Quote: ... and VSV g-glycoprotein Env (pMD2.G Addgene: 12259), together with pLentiRhoA2G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... VSV-G envelope expressing plasmid pMD2.G (RRID: Addgene_12259) and lentiviral packaging plasmid psPAX2 (RRID ...
-
bioRxiv - Microbiology 2024Quote: ... and pMD2.G plasmid expressing VSV-G (Addgene #12259) in a ratio of 1:1:0.2 respectively using polyethyleneimine ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Microbiology 2022Quote: GFP and myc-tagged 14-3-3ε were generated as follows: a G-block containing the full-length 14-3-3ε protein (IDT) was cloned into pEGFP-C1 (Addgene #2487) using XhoI and BamHI restriction sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the VSV-g-envelope plasmid pMD2.G (Addgene, 12259). The plasmids were diluted in Opti-MEM and Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the VSV-g envelope plasmid pMD2.G (Addgene, 12259). The plasmids were diluted in Opti-MEM and Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the VSV-G envelope plasmid pMD2.G (Addgene, #12259). Transfection reactions were assembled in reduced serum media (Opti-MEM ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G envelope expressing pMD2.G (Addgene, Plasmid#12259) plasmids ...
-
bioRxiv - Immunology 2021Quote: ... 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259) and 1 μg shRNA plasmid using Fugene 6 (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... with envelope-expressing plasmid pMD2.G-VSV-G (Addgene #12259). HEK293T cells were plated 24 h prior to transfection in 10 cm plates at density of 2 × 104 cells/cm2 ...
-
bioRxiv - Systems Biology 2023Quote: ... and an envelope plasmid containing VSV-G (pMD2.G, Addgene). Media was changed 6-8 hours after transfection ...
-
bioRxiv - Genetics 2023Quote: ... 360 ng pMD2.g VSV-G envelope vector (Addgene #12259), and 1.2 ug of purified plasmid library using 5.8 uL of X-tremeGENE HPTM DNA Transfection Reagent (Millipore Sigma #06366236001) ...
-
bioRxiv - Biophysics 2023Quote: ... and VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259) with Lipofectamine-3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... G (#12259, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Bioengineering 2021Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: pMD2.G (Addgene, Watertown ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...