Labshake search
Citations for Addgene :
251 - 300 of 4249 citations for 8 HYDROXY 1 3 DIOXOLO 4 5 G QUINOLINE 7 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the VSV-g-envelope plasmid pMD2.G (Addgene, 12259). The plasmids were diluted in Opti-MEM and Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the VSV-g envelope plasmid pMD2.G (Addgene, 12259). The plasmids were diluted in Opti-MEM and Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the VSV-G envelope plasmid pMD2.G (Addgene, #12259). Transfection reactions were assembled in reduced serum media (Opti-MEM ...
-
bioRxiv - Cancer Biology 2019Quote: ... and VSV-G envelope expressing pMD2.G (Addgene, Plasmid#12259) plasmids ...
-
bioRxiv - Immunology 2021Quote: ... 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259) and 1 μg shRNA plasmid using Fugene 6 (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... with envelope-expressing plasmid pMD2.G-VSV-G (Addgene #12259). HEK293T cells were plated 24 h prior to transfection in 10 cm plates at density of 2 × 104 cells/cm2 ...
-
bioRxiv - Systems Biology 2023Quote: ... and an envelope plasmid containing VSV-G (pMD2.G, Addgene). Media was changed 6-8 hours after transfection ...
-
bioRxiv - Genetics 2023Quote: ... 360 ng pMD2.g VSV-G envelope vector (Addgene #12259), and 1.2 ug of purified plasmid library using 5.8 uL of X-tremeGENE HPTM DNA Transfection Reagent (Millipore Sigma #06366236001) ...
-
bioRxiv - Biophysics 2023Quote: ... and VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259) with Lipofectamine-3000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 μg psPAX2 (#12260, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10μg pAAV2/8 (Addgene #112864) and 20μg pAdDeltaF6 (Addgene #112867 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Molecular Biology 2020Quote: pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... G (#12259, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Bioengineering 2021Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: pMD2.G (Addgene, Watertown ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Neuroscience 2020Quote: ... a VSV-G envelope-expressing plasmid pMD2.G (Addgene plasmid #12259), and the packaging plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... and the VSV-G envelope plasmid PMD2.G (Addgene Plasmid #12259). 48 hours after transfection ...
-
bioRxiv - Immunology 2019Quote: ... and VSV-G-expressing envelope plasmid pCMV-VSV-G (8454, Addgene) were transfected into HEK293 T cells using jetPRIME transfection reagent (114-15 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the VSV-G envelope plasmid pMD2.G (plasmid #12259, Addgene) from Didier Trono (Ecole Polytechnique Fédérale de Lausanne ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 500 ng of pMD2.G (VSV-G) (Addgene plasmid #12259), using Lipofectamine 2000 at a ratio of 1:2.5 (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and VSV-G envelope expressing plasmid PMD2.G (Addgene, plasmid #12259) were gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and VSV-G envelope (pMD2.G, gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the pMD2.G plasmid encoding the VSV-G envelope (Addgene #12259), and the psPAX2 packaging plasmid (Addgene #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... 1.5 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 1.5 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5 µg VSV-G envelope plasmid (pMD2.G, Addgene #12259) into HEK293T cells in 57 µL Opti-MEM and 6 µL FuGENE HD (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...