Labshake search
Citations for Addgene :
251 - 300 of 2264 citations for 8 Chloro 4 methyl 1 2 dihydroquinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 2 μg of I-SceI expression plasmid pCBASceI (Addgene #26477) using lipofectamine® 3000 (#11668019 ...
-
bioRxiv - Biochemistry 2019Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Genomics 2019Quote: ... The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene. Exponentially growing 293T cells were split and seeded at 8 x 106 cells in 100 mm dishes in RPMI 1640 medium at 37C ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Neuroscience 2022Quote: pAAV2/2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, Roth Lab) was injected intraocularly in VGluT3-Cre mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg pSPAX2 (a kind gift from Didier Trono; Addgene #12260), and 2 µg of pcDNA3- SΔ19 with PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg pMD2.G envelope plasmid (plasmid #12259; Addgene, Teddington, UK), and 12 μg of the pLJM1 vector for overexpression (plasmid #19319 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µL plasmid DNA (ERmoxGFP43, Addgene Cat. # 68072, 420 ng/µL), and 96 µL of PBS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: The Capture sequence 2 was added to the gRNA_Purp_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2022Quote: [2] piggyBac backbone from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene, ID #104875) (Riabinina et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes an N-terminal TEV protease cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509; http://n2t.net/addgene:51509; RRID:Addgene_51509)55.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of plasmid expressing CRISPR-Cas9 and guide (Addgene #42230) and 40 pmol ssDNA repair template were transfected using Lipofectamine 3000 (Invitrogen L3000001 ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA3.1-Ha-Dynamin 2.K44A (gift of S. Schmid, Addgene 34685), pEGFPC1 (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... pEGFP-Dynamin 2.K44A (gift of P. De Camilli; Addgene 22301), and pEGFP-Dynamin 2ΔPRD (50 ...
-
bioRxiv - Neuroscience 2024Quote: ... driven by synapsin promoter (Addgene, 100843-AAV9, 2×109 vg/coverslip) (20) ...