Labshake search
Citations for Addgene :
401 - 450 of 3055 citations for 8 Chloro 1 2 3 4 tetrahydro 1 4 methylphenyl sulfonyl 5H 1 benzazepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Genomics 2019Quote: ... pENTR4-GST 6P-1 (w487-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17741) (22) ...
-
bioRxiv - Neuroscience 2020Quote: ... Animals were infused bilaterally with 1 μl of AAV5-hSyn-DIO-hM4Di-mCherry (1012 particles.ml−1, Addgene, Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA sequences targeting LINE-1 ORF169 were cloned into pLKO.1-TRC cloning vector (Addgene, cat# 10878) using EcoR1 and AgeI restriction enzyme digestion ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... Thermo Fisher Scientific) or scrambled control (5’-CCTAAGGTTAAGTCGCCCTCG-3’, Addgene Plasmid #26701). Viral particles were produced from 293FT cells by co-transfection with viral vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for stereotaxic injections into wildtype C57BL/6J mice ...
-
bioRxiv - Neuroscience 2020Quote: ... we used a Cre-dependent AAV vector that robustly expresses EGFP within the cytoplasm of Cre-expressing infected neurons (AAV2/1.pCAG.FLEX.EGFP.WPRE.bGH, Penn Vector Core, AV-1-ALL854, Addgene ID 51502).
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434; w785-1: Addgene plasmid #26730 ...
-
bioRxiv - Neuroscience 2019Quote: ... a pan-neuronal AAV expressing EGFP (rAAV2/1.hSynapsin.EGFP.WPRE.bGH, Penn Vector Core, AV-1-PV1696, Addgene ID 105539) was used for injections into wildtype C57BL/6J mice at postnatal day 56 (stock no ...
-
bioRxiv - Neuroscience 2022Quote: ... received 0.8 uL of a 1:1 mixture of AAV9-Syn-Flex-GCaMP6f (2.1 * 10^13 GC/mL; Addgene) and AAV8-GAD1-cre (8.29×10^13 GC/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2023Quote: BMDMs grown on 4-well chamber were transfected with GEM-CEPIA1er (Addgene) (Suzuki et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Cell Biology 2020Quote: ... h-lin-28 and EBNA-1 (Addgene plasmids #27077 ...