Labshake search
Citations for Addgene :
1 - 50 of 1425 citations for 8 Bromo 5 6 difluoro 2 methylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Pathology 2023Quote: ... pAAV2/8 (Addgene 112864 deposited by Dr Wilson ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 μg psPAX2 (#12260, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10μg pAAV2/8 (Addgene #112864) and 20μg pAdDeltaF6 (Addgene #112867 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cargo RNA expression plasmids for mCherry-MS2×8 and Cre-MS2×8 were pFH2.22 (Addgene, #205537) and pJAM1.52 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Genomics 2022Quote: ... pAAV2/8 Rep/Cap plasmid (Addgene, plasmid #112864 ...
-
bioRxiv - Genetics 2019Quote: ... and 8 μg of psPAX2 (Addgene) plasmid per 100 mm dish by using JetPRIME (PolyPlus ...