Labshake search
Citations for Addgene :
701 - 750 of 3166 citations for 8 BROMO 4 METHYLTHIO 7 PHENYLPYRAZOLO 1 5 A 1 3 5 TRIAZIN 2 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ...
-
bioRxiv - Developmental Biology 2022Quote: The following plasmids were used: mCherry-EB3-7 (Addgene 55037), Ect2-GFP (Dehapiot et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-2xML1N (#67797) or mNeonGreen-EB3-7 were from Addgene or Allele Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-myc-OGA(1-400) and (344)pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)15 (gift from Christina Woo; Addgene plasmid 168095 and 168197). Additionally ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.7-1 μL of virus (AAV2-CMV-mCreb, 1×1012 Addgene Plasmid #68551 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1, Addgene), CAV-2 Cre (Titer ≥ 2.5×1011 pp ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-160 and 1-220 were cloned in pEBG-GST (Addgene). The vector expressing eGFP was described previously (49) ...
-
bioRxiv - Neuroscience 2024Quote: ... were injected a 1:1 mixture of pAAV.Syn.GCaMP6f.WPRE.SV40 (Addgene, stock #100837) virus and pAAV.CAG.LSL.tdTomato (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Cell Biology 2019Quote: ... Two gRNA sequences targeting different regions of linc00899 (guide 1 and 2) were cloned into pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955). All clones were verified by Sanger sequencing using mU6 forward primers (Supplementary Methods) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Immunology 2023Quote: ... were transfected with the above retroviral plasmids encoding the 8-24 or 8-DN TCRβ transgene and the pCL-Eco packaging vector (Addgene) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: The zebrafish gfap promoter 51 was derived from the Addgene plasmid: pEGFP-gfap(Intron1/5’/Exon1-zebrafish) (Addgene, #39761) and lssmKate2 65 was derived from the Addgene plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... and LT1 (305 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454, 5 μg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Addgene plasmid # 12456) and 5 ng of Renilla luciferase control plasmid (a gift from David Bartel; Addgene plasmid # 12179) in each well ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... and 5 mg sgRNA cloned into the BsmBI restriction site of the MLM3636 plasmid (gift from Keith Joung, Addgene plasmid #43860 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2022Quote: ... and 210nl of Arch 3.0- eYFP (rAAV2-EF1a-double floxed-eArch3.0-eYFP; 5 × 1011 GC per ml; UNC Vector Core or eYFP (Addgene plasmid 20296 ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Genetics 2019Quote: ... Vector pZZ113 containing sgRNA expression cassette against cbr-dpy-5 was derived from PU6∷unc-119_sgRNA (Addgene plasmid # 46169) as described (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: Four mice (experimental group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-ChR2-WPRE-eYFP (Addgene viral prep 20298-AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... This middle entry vector was Gateway recombined using a 5’ entry zebrafish ubiquitious promoter (Addgene #2732, Watertown, MA, USA), a 3’ entry pA vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CasX2 ORF was amplified from pBLO 62.5 (pBLO 62.5 was a gift from Jennifer Doudna and Benjamin Oakes, Addgene plasmid #123124; http://n2t.net/addgene:123124; RRID:Addgene 123124) [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected the Cre-dependent constructs AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) and AAV-EF1a-DIO-eNpHR3.0-mCherry-WPRE (5×1012 gc/mL ...