Labshake search
Citations for Addgene :
201 - 250 of 2063 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The 5’ Entry p5Efli1ep (#31160) purchased from Addgene was originally from Nathan Lawson Lab [56] ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µg of pMDLg/RRE (Addgene plasmid #12251), 5 µg of pRSV/Rev (Addgene plasmid #12253) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µg of pRSV/Rev (Addgene plasmid #12253), and 3.5 µg of pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Microbiology 2022Quote: ... or pLKO.1-blast (pLKO.1-blast was a gift from Keith Mostov (Addgene plasmid #26655 ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs included: AAV2/1-hSynapsin-1-jGCaMP8 constructs (pGP-AAV-syn1-jGCaMP8f-WPRE, Addgene plasmid #162376 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 1 μl of AAV5-hSyn-DIO-mCherry (1012 particles.ml−1, Addgene, #50459-AAV5). The virus was infused at a rate of 0.2 μL.min−1 using microinjection cannula (33-gauge ...
-
bioRxiv - Molecular Biology 2020Quote: ... were diluted (1:100) and cloned into pLKO.1 TRC-Cloning vector (Addgene # 10878) that had been digested with EcoRI and AgeI ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... ZIF-1 and GFP-nanobody::ZIF-1 sequences were amplified from pOD2046 (Addgene #89367) (Wang et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... apr-1 and ecps-1 were obtained from a library supplied by Ahringer (Addgene) (Kamath et al ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... residues 1-271 (Addgene #138421), and residues 1-133 (Addgene #138422 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PLKO.1 (Addgene, #10878 [34]), for expression of Cas12a gRNAs ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #1 (TRCN0000281950, Addgene #136584), shNRF2 #2 (TRCN0000284998 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #1 (TRCN0000416347, Addgene #136581), shJUND #2 (TRCN0000416920 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 µg psPAX2 (Addgene, 12260), 2 µg lentiviral plasmids and 10 µl dH2O was further added with 150 µl serum free DMEM and 9 µl X-tremeGENE HP DNA Transfection Reagent (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.shNkx2-1 (Addgene Plasmid #32400) or pLKO.shScramble (Addgene Plasmid #1864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 Lentiviral constructs (Addgene) were transfected into 293FT cells using 35μg polyethylenimine per transfection (Alfa Aesar) ...
-
bioRxiv - Cell Biology 2020Quote: pLKO.1 puro (Addgene #8453) was modified to carry:
-
bioRxiv - Neuroscience 2022Quote: pLKO.1-TRC (Addgene, 10878) vector was used for the knockdown of YTHDF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-neo (Addgene, 13425) was used as the backbone ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... pISH-Gucy2d-1 (Addgene, #105459), pISH-V1rb1 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1.syn.jGCaMP7s 50 (Addgene, 104487-AAV1 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-1:PXN-EGFP (Addgene plasmid #87420 ...
-
bioRxiv - Cell Biology 2022Quote: ... pMA122 (peel-1, Addgene #34873), and co-injection markers were injected into N2 young adult worms ...
-
bioRxiv - Cell Biology 2023Quote: ... pLKO.1-Scrambled (Addgene #136035)9 was modified to express H2B-mRuby3 for visual identification of transduced cells based on a nuclear fluorescence signal10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pLKO.1 (Addgene #8453) lentiviral vector was digested with AgeI (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-110 (Addgene #213500), α-syn 96-140 (Addgene #213501) ...
-
bioRxiv - Neuroscience 2023Quote: ... α-syn 1-95 (Addgene #213499), α-syn 1-110 (Addgene #213500) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PLKO.1 (Plasmid #8453, Addgene) backbone was used ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Microbiology 2019Quote: ... TAAGATCTGTTTAGTGGTGATGGTGATGATGTTTTCCCTTTTGACCTGCGTG EphA2 sgRNA constructs oligos: 5-AAACGTGTGCGCTACTCGGAGCCTC-3 and 5-CACCGGAAGCGCGGCATGGAGCTCC-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). EphA4 sgRNA constructs ...
-
bioRxiv - Microbiology 2019Quote: ... EphA4 sgRNA constructs: oligos 5-AAACCACAGTACATTTTTGGCACAC-3 and 5-CACCGTGTGCCAAAAATGTACTGTG-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). Sequencing was performed for all constructs to confirm the correct sequence.
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...