Labshake search
Citations for Addgene :
651 - 700 of 2439 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene; also pre-diluted to a 1:4 ratio in filtered 1x PBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Genetics 2020Quote: ... Male mice at ages 8-12 weeks were Jugular vein injected with 1011 particles of AAV expressing either Cre recombinase (Addgene 107787-AAV8) or GFP (Addgene 105535-AAV8 ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777).
-
bioRxiv - Molecular Biology 2020Quote: ... and pCMV4-3 HA/IkB-alpha was a gift from Warner Greene (Addgene, #21985). To generate firefly luciferase (Fluc)-expressing vector (pNL1.1.PGK[Fluc/PGK] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328), and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Genomics 2020Quote: ... We then selected then 3 sgRNAs to be cloned into lentiGuide-Puro (52963, Addgene) as previously described95 ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777). The oligos are listed in Table S3.
-
bioRxiv - Immunology 2022Quote: The genome-wide library Toronto KnockOut (TKO) CRISPR Library – Version 3 (TKOv3, #90294, Addgene) 39 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...