Labshake search
Citations for Addgene :
351 - 400 of 1030 citations for 8 4 Chlorophenoxy 2 methylideneoctanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159). To express nsp10-14 and nsp14-10 fusion proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... or 2) the depolarizing opsin Channelrhodopsin (AAV1.EF1a.DIO.hChR2.EYF; Addgene) was expressed in a cre-dependent manner in interneurons using Gad2-IRES-Cre C57BL/6J mice (Jackson Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259) per well with LipoD293™ In Vitro DNA Transfection Reagent ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... we used the 2-vector system (lenti-guide Puro; Addgene #1000000049 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Sabatini lab (MIT) (Wang et al., 2; Addgene Catalogue # 51047). The libraries were amplified using published protocol at Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 μg of the envelope plasmid (pMDG.2, RRID: Addgene_12259) and 0.9 μg of the packaging plasmid (psPAX2 RRID ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... using pcDNA3-SARS-CoV-2-RBD-8his (Addgene #145145, (33)) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904), pBS-KS-attB2-SA(0)-T2A-VP16AD-Hsp70 (Addgene #62905) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260) using Jet Pei reagent (Polyplus ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Systems Biology 2024Quote: ... each promoter was transferred to the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Developmental Biology 2021Quote: ... associated palmitoylated fluorescent protein was generated by the addition of the 20-amino acid sequence of ratGAP-43 MLCCMRRTKQVEKNDEDQKI to the N-terminus of the monomeric enhanced GFP (eGFP) (K. Svoboda, Addgene plasmid 18696) through sequential PCR amplification to make a pm-eGFP sequence ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... A fragment containing three repetitions of the retinoic acid response element (RARE) sequence followed by the weak promoter SV40 was sub-cloned from pGL3-RARE-luciferase (Addgene Plasmid #13458), a kind gift of the Underhill Lab64 ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Genetics 2021Quote: ... the cassette containing the C terminus half of the DddAtox (split at 1397 amino acid position) and UGI was amplified from the DdCBE plasmid (Addgene plasmid no. 157844). The PCR amplicon was digested with XbaI and BsU36I restriction enzyme and cloned in the pkTol2c-FusXTBE-N vector linearized with XbaI and Bsu36I to generate pkTol2c-FusXTBE-C plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 2 μg of I-SceI expression plasmid pCBASceI (Addgene #26477) using lipofectamine® 3000 (#11668019 ...
-
bioRxiv - Biochemistry 2019Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Genomics 2019Quote: ... The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene. Exponentially growing 293T cells were split and seeded at 8 x 106 cells in 100 mm dishes in RPMI 1640 medium at 37C ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...