Labshake search
Citations for Addgene :
51 - 100 of 1275 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated viruses with a null vector (Addgene, AV-8-PV0148) were used as controls.
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products and a pCS2+8 vector (Gokirmak et al., 2012) (Addgene) were digested with XbaI and BamHI (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-hM4D(Gi)-mCherry (≥8 × 1012vg/mL, Addgene #44362). The needle remained in place for an additional 5 minutes after each injection to allow for diffusion of the virus and then the needle was slowly removed from the brain ...
-
bioRxiv - Neuroscience 2024Quote: ... rAAV5-hsyn-mCherry-WPRE (Addgene #114472, Titer: 8 x 1012 GC/mL) was injected unilaterally (60-100 nL at 40 nL/min ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 8 hSyn-DIO-mCherry (2.2 × 1013 gp/mL) (Addgene #50459)
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Neuroscience 2022Quote: - AAV-hSyn-DIO-hM4D(Gi)-mCherry (Addgene 44362 or Zürich VVF v84, serotype 8), here referred to as AAV-DIO-hM4Di-mCherry ...
-
bioRxiv - Immunology 2022Quote: ... and −8 were cloned into the LentiCRISPR v2 plasmid (Feng Zhang, Addgene plasmid #52961). The sequences for the guide RNAs were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... donor constructs were: AICSDP-8:TOMM20-mEGFP (Addgene plasmid #87423; http://n2t.net/addgene:87423; RRID:Addgene_87423), AICSDP-13:FBL-mEGFP (Addgene plasmid #87427 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Microbiology 2022Quote: Transfection of 24ST1NLESG cells was carried out with 8 μg PAK1 expression plasmid (Addgene, cat # 12208), PAK2 expression plasmid (Sino Biologicals ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... mice were injected with AAV2/8-CaMKII-hM4D(Gi)-mCherry (Addgene, titer: 2.3*1013 genome/mL) or AAV2/5-CaMKII-mCherry (UNC Vector Core ...
-
bioRxiv - Biochemistry 2023Quote: ... with the only difference being the use of the pAAV2/8 packing plasmid (Addgene Plasmid #112864) for serotyping ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931; http://n2t.net/addgene:34931; RRID:Addgene_34931) (Gokirmak et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Addgene #55639 (packaged in AAV2/1) AAV2/8-EF1a-fDIO-ChrimsonR-mRuby2-KV2.1TS modified from Addgene #124603 pAAV-hSyn1-SIO-stGtACR2-FusionRed ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Eed-pcDNA was described previously by us (8) and Kdm6b-pcDNA was obtained from Addgene (Plasmid # 24167). Each mix was transferred to a Nucleocuvette and electroporated using the 4D-nucleofector Core Unit (LONZA ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...