Labshake search
Citations for Addgene :
1 - 50 of 3109 citations for 8' Bromo 2' 3' dihydro 1'h spiro cyclopropane 1 4' isoquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... h-lin-28 and EBNA-1 (Addgene plasmids #27077 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cancer Biology 2024Quote: WNK1 depletion by CRISPR-Cas9 editing was done by using two independent gRNAs targeting Exon-1 (5’-CGCCGACGCTGTGACCGGC-3’) and Exon-4 (5’-ACTTACACTGGTCACGCGA-3’) cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector (Addgene #67974). TET-ON-Cas9 expressing cells were infected and BFP-positive cell FACS sorted ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... myofibers at differentiation day 3-4 were infected using 1 μl/ml of the AAV9-pAAV.CAG.GCaMP6s.WPRE.SV40 (Addgene viral prep # 100844-AAV9 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...