Labshake search
Citations for Addgene :
151 - 200 of 3193 citations for 7H Pyrrolo 2 3 c pyridin 7 one 1 6 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Cancer Biology 2024Quote: All-in-One-GFP and All-in-One-mCherry plasmids were purchased from Addgene (AIO-GFP #74119 and AIO-mCherry #74120). Their constructions have been described in (22).
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells were transfected with mEmerald-Sec61b-C1 (Addgene #90992 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ...
-
bioRxiv - Developmental Biology 2022Quote: The following plasmids were used: mCherry-EB3-7 (Addgene 55037), Ect2-GFP (Dehapiot et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-2xML1N (#67797) or mNeonGreen-EB3-7 were from Addgene or Allele Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Developmental Biology 2019Quote: ... The p3E vector was built by cloning a U6c-gRN(#7)NA#1 fragment (gBlock, IDT) into a KpnI/XhoI site in p3E-MCS (Addgene #75174).
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...