Labshake search
Citations for Addgene :
1 - 50 of 2135 citations for 7 nitro 3 phenyl 1 naphthol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1 ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids mIFP12-Rab4a-7 (#56261) and mIFP-Golgi-7 (#56221) were purchased from Addgene.
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426 ...
-
bioRxiv - Cell Biology 2019Quote: mPlum-Lifeact-7 (Addgene plasmid # 54679) and mCherry-Sec61 β (Addgene plasmid # 49155 ...
-
bioRxiv - Neuroscience 2020Quote: ... or mCherry-Mito-7 (Addgene #55102) (34 ...
-
bioRxiv - Neuroscience 2021Quote: The plasmid pT7-7 (Addgene 36046)[29] coding for the human α-synuclein wild type (α-syn ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pmTagBFP2-Lifeact-7 (Addgene plasmid #54602) from M ...
-
bioRxiv - Cell Biology 2022Quote: ... mTagRFP-T2-Mito-7 (Addgene #58041) (referred to as mitoRFP in the text) ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.
-
bioRxiv - Cell Biology 2020Quote: ... and to link GFP11×7 tag (from Addgene Plasmid #70224 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).