Labshake search
Citations for Addgene :
151 - 200 of 2307 citations for 7 Oxabicyclo 2.2.1 heptan 2 ol 4 methyl 1 1 methylethyl 1R 2S 4R rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... plasmid and another population with mEGFP-lifeact-7 (Addgene #58470 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Neuroscience 2024Quote: ... we microinjected a 1:1 ratio of AAV1.hSyn.GCaMP6s.WPRE.SV40 (Addgene) and the somatically targeted AAV1.hSyn.ChrimsonR.mRuby2.ST (University of Minnesota Viral Vector and Cloning Core ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 (Addgene plasmid 8453 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells were transfected with mEmerald-Sec61b-C1 (Addgene #90992 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...