Labshake search
Citations for Addgene :
151 - 200 of 1780 citations for 7 NITRO 3 4 DIHYDRO 1H QUINOXALIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and EBFP2-Nucleus-7 (Addgene #55249, a gift from Michael Davidson). The targeting sequences for the nucleus ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene, 54491).
-
bioRxiv - Cell Biology 2022Quote: ... The mCherry-EB3-7 vector was obtained from Addgene (addgene #55037) and the mCherry was removed and replaced by a GFP sequence using AgeI/BsrG1 restriction enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Cancer Biology 2021Quote: The Tet-pLKO-puro all-in-one vector (RRID: Addgene_21915) including a puromycin resistance cassette and a tet-responsive element for expression of shRNAs was established according to a publicly available protocol (46 ...
-
bioRxiv - Neuroscience 2022Quote: ... One insert consisted of the U6-sgRNA cassette from Addgene 71236 (gifted from Charles Gersbach [46]) ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2021Quote: ... mEos2-Actin-7 was a gift from Michael Davidson (Addgene plasmid # 57339)(87) ...
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2019Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54491)
-
bioRxiv - Molecular Biology 2021Quote: ... The 8x let-7 BS psiCHECK2 plasmid was acquired from Addgene (#20931), and the 3x miRNA BS psiCHECK2 plasmids (used in Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931) to localize mitochondria ...
-
bioRxiv - Immunology 2020Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid #54663). Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Biochemistry 2019Quote: ... WT αSyn/pT7-7 plasmid was procured from Addgene (www.addgene.com; plasmid #36046). This vector was also used as a backbone for cloning His6-tagged WT-αSyn by PCR amplification.
-
bioRxiv - Cell Biology 2021Quote: ... EBFP2-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 55248) [39] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The CaMV terminator was isolated from the PABE-7 plasmid (Addgene #115628) [28] and cloned into an entry vector via Gibson assembly.
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426; http://n2t.net/addgene:87426; RRID:Addgene_87426).
-
bioRxiv - Biochemistry 2023Quote: ... and transfected with plasmids encoding either mCherry-Golgi-7 (Addgene, Watertown, MA), mCherry-ER-3 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... a total of 4 guides flanking the region to be deleted (2 on each side) were cloned into the pX459-v2 vector (Addgene #62988) (Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 4 μg of corresponding transfer plasmid and 2 μg each of the four helper plasmids: pMDLg/pRRE (Addgene, #12251), pRSV/REV (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Genomics 2022Quote: ... One double-stranded gRNA was cloned into pBFv-U6.2 (Addgene #138400), and the other double-stranded gRNA was cloned into pBFv-U6.2B (Addgene #138401) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the genome editing one vector system (PX459) (104142, Addgene, MA, USA) was used ...