Labshake search
Citations for Addgene :
201 - 250 of 964 citations for 7 Methylidenebicyclo 3.3.1 nonan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... These plasmids are based on all-in-one pSpCas9(BB)-2A-Puro (px459) (Addgene #62988) V2.0 and pSpCas9n(BB)-2A-Puro (px462 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... using a similar all-in-one lentivirus that did not express GFP (pLIX-403; Addgene_41395), and were made monoclonal via single-cell sorting to ensure comparable inducible expression of UNK in cells within a population and among populations expressing Flag-HA-tagged UNKWT ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Biochemistry 2023Quote: ... we constructed a constitutive all-in-one dead SaCas9 (dSaCas9) system from construct (Addgene #164563) via Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ; http://n2t.net/addgene:54663 ; RRID:Addgene_54663). Vectashield antifade mounting medium (Vectorlabs ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Cell Biology 2022Quote: ... The mCh-NLS plasmid was generated by Michael Davidson and obtained from Addgene (mCh-Nucleus-7, #55110). The pericentrin-RFP plasmid (Gillingham & Munro ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245; http://n2t.net/addgene:54245; RRID:Addgene_54245). pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Nucleus-7 plasmid was generated by Michael Davidson and obtained from Addgene (Addgene plasmid no. 55110). Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126; http://n2t.net/addgene:55126; RRID:Addgene_55126) PH-Btk-GFP was a gift from Tamas Balla (Addgene plasmid # 51463 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... The sequence was then excised with XbaI and HindIII and inserted into pT7-7 plasmid (Addgene #36046) between the XbaI and HindIII restriction sites to generate a plasmid template construct (pT7-fastFISH (pT7-fF)).
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127; http://n2t.net/addgene:55127; RRID:Addgene_55127). Lamp1-RFP62 was a gift from Walther Mothes (Addgene plasmid # 1817 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874; http://n2t.net/addgene:55874; RRID:Addgene_55874). mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 Chrna2-Crewt/wt) were injected bilaterally with 300 nl of AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene, LOT 44361-AAV9 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...