Labshake search
Citations for Addgene :
301 - 350 of 2428 citations for 7 Chloro 6 fluoro 1 4' fluoro phenyl 1 4 dihydro 4 oxo 3 quinoline carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Cancer Biology 2021Quote: ... HT-1080N cells were transduced with lentiviruses carrying the reverse tetracycline-controlled transactivator 3 under a CMV promoter (CMV-rtTA3) (Cat# w756-1, Addgene). HT-1080N-rtTA3 cell lines were selected in 10 μg/mL blasticidin (Cat # A1113902 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.
-
bioRxiv - Cell Biology 2020Quote: ... and to link GFP11×7 tag (from Addgene Plasmid #70224 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Neuroscience 2021Quote: ... DJ-1 (pGEX-5X-1-DJ1-WT; Addgene) or pcDNA plus RFP plasmid(57 ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... and a 1:1 solution of AAV1.Syn.GCaMP6f.WPRE.SV40 (Addgene) and AAV1.mDlx.GFP-GCaMP6f-Fishell-2.WPRE.SV40 (Penn Vector Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pRSFDuet-1 IntS8 AA 1-308 (Addgene #196905), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1 mixture of pENN.AAV.CamKII 0.4.Cre.SV40(AAV1; Addgene #105558 ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... plasmid and another population with mEGFP-lifeact-7 (Addgene #58470 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Neuroscience 2024Quote: ... we microinjected a 1:1 ratio of AAV1.hSyn.GCaMP6s.WPRE.SV40 (Addgene) and the somatically targeted AAV1.hSyn.ChrimsonR.mRuby2.ST (University of Minnesota Viral Vector and Cloning Core ...
-
bioRxiv - Cell Biology 2021Quote: ... pLKO.1 (Addgene plasmid 8453 ...
-
bioRxiv - Neuroscience 2021Quote: ... a 1:1 mixture of AAV9-hSyn-Cre (1:40000 dilution, Addgene: 105553-AAV9, titer: 3.3×1013vg/ml) and AAV1-Syn-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...