Labshake search
Citations for Addgene :
151 - 200 of 1895 citations for 7 Bromo 2 methylimidazo 4 5 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Soluble mCherry (pmCherry-N3 plasmid) was cloned from pmCherry-mito-7 (Addgene #55102).
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was injected unilaterally at a rate of 2nL/sec ...
-
bioRxiv - Neuroscience 2022Quote: ... or pAAV-hSyn-DIO-mCherry (Control mCherry reporter; Addgene #50459, titers: 7×1012 vg/ml) into the VTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde, viral titer ≥ 7×1012 vg/mL; Addgene), and Clozapine N-oxide (CNO ...
-
bioRxiv - Cell Biology 2023Quote: Expression constructs used in this study include pCI-mScarlet (Addgene #85042; pC1-mScarlet-Syp [7]), pCIG2-GFP-MACF43 [42] ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; virus titer ≥ 7×10¹² vg/mL) viruses were performed on adult anesthetized (isoflurane ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-hSyn-DIO-hM3D(Gq)-mCherry (400 nl at titer 7×1012, Addgene, #44361-AAV5) for activation ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.1 µL of AAV2-pCAG-FLEX-eGFP (Addgene #51502; titer: 7×10¹² vg/mL) was injected into the SNr during the same surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... pMXs-c-Myc (Addgene Plasmid #13375) per 10 cm dish using Fugene 6 (Catalog# Promega# E2691) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT3-EF1a-c-Met (31784, Addgene) or pCMV-Hygro-LINC01510 (Twist Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2021Quote: ... C-terminal MBP plus His6 (Addgene_37237); N-terminal His6 plus glutathione S-transferase (GST ...
-
bioRxiv - Cancer Biology 2021Quote: ... or C-Flag-Rela (Addgene #20012) using 25μL Lipofectamine and 4.5μg plasmid DNA in 600μL Optimem total ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...