Labshake search
Citations for Addgene :
601 - 650 of 929 citations for 7 Bromo 2 Tetralone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Plasmid pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian (Addgene plasmid # 145780)68 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Microbiology 2022Quote: ... UL123 was also cloned into pLVX-EF1alpha-SARS-CoV-2-nsp1-2XStrep-IRES-Puro (Addgene plasmid #141367) in place of the SARS-CoV-2-nsp1-2XStrep cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... the SARS-CoV-2 S 6P expression vector was a gift from Jason McLellan (Addgene plasmid #154754). The secreted protein was captured by Strep-Tactin affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... pCAGGS-SARS-CoV-2 S D614G (# 156421) and pcDNA3.1 vectors were obtained from Addgene (Watertown, MA, USA), and Invitrogen (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... The pDONR223-PRKCB2 (PKCβII, uniprot identifier: P05771-2) was a gift from William Hahn & David Root (Addgene plasmid #23746 ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/2-hsyn-DIO-hM4D(Gi)-mCherry was obtained from Addgene (plasmid #44362, 4.6×1012 GC/ml). For optogenetic activation ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pCOLA-Gent-EM7-Erv1p-PDI were both cloned with 2 fragment gibson assemblies (Addgene Cat#202486). For each assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH51288 and pICH41414 (2×35S and 35S terminator; Addgene #50269 and #50337; Engler et al., 2014) in a BsaI Golden Gate reaction to generate binary vectors containing the fragment-swapped Rcr3/Pip1 hybrids driven by the double 35S CaMV promoter and targeted to the apoplast using a NtPR1a signal peptide ...
-
bioRxiv - Molecular Biology 2024Quote: The plasmid pLVX-EF1alpha-SARS-CoV-2-orf6-2xStrep-IRES-Puro (Addgene plasmid #141387 from Nevan Krogan) [12] was used for the overexpression of the accessory proteins ORF6 ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794; http://n2t.net/addgene:55794; RRID:Addgene_55794) 39 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814; http://n2t.net/addgene:32814; RRID:Addgene_32814). The cDNA was subcloned into pcDNA3 between KpnI and XbaI restriction sites and under the T7 promoter for expression in Xenopus laevis oocytes ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754) 30 ...
-
bioRxiv - Immunology 2021Quote: SARS CoV-2 pseudotyped lentiviruses were produced by transfecting the 293T cells with the pLenti-Puro vectors (Addgene) expressing Luciferase or β-Galactosidase ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867 ...
-
bioRxiv - Immunology 2021Quote: ... The bacterial expression construct for full-length SARS-CoV-2 nucleocapsid was a gift from Nicolas Fawzi (Addgene plasmid # 157867; http://n2t.net/addgene:157867; RRID:Addgene_157867)69 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754; http://n2t.net/addgene:154754; RRID:Addgene_154754). This construct has been modified to include a cleavage site substitution as well as six prolines for stability (35) ...
-
bioRxiv - Cell Biology 2021Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 days with pXPR_011 expressing eGFP (Addgene; 59702) and a short guide RNA (sgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... we co-electroporated animals at stage 46-47 with pGP-CMV-GCaMP6f (2 mg/mL, Addgene plasmid # 40755) and CMV-turboRFP (1mg/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068; http://n2t.net/addgene:19068 ; RRID:Addgene_19068). FLT3-WT and FLT3-ITD ORFs were cloned in pLEX_307 (gift from David Root (Addgene plasmid #41392 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899; http://n2t.net/addgene:83899; RRID:Addgene_83899) (88 ...
-
bioRxiv - Microbiology 2021Quote: ... and pLenti CMV GFP Neo (657-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17447). Expression plasmids SARS2-S2’-AA ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780; http://n2t.net/addgene:145780; RRID:Addgene_145780) 38 ...
-
bioRxiv - Immunology 2020Quote: ... The vector pEQ276 (encoding CMV IE1 and 2 genes) was a gift from Adam Geballe (Addgene plasmid #83945)67 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Streptomyces pyogenes (sp) guide RNA sequences (Table 2) were cloned into the LentiGuide-Puro plasmid (plasmid #52963, Addgene). lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cell Biology 2019Quote: ... we designed sgRNAs targeting exon 2 using CHOPCHOP (http://chopchop.cbu.uib.no/index.php) and cloned these sequences into lentiguide-puro (Addgene, cat. 52962). All lentiviruses were prepared by cotransfecting HEK293T cells with the lentivector ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Genomics 2020Quote: FUS-/- cells were generated by transient transfection of U-2 OS cells with pX459 (v2, Addgene plasmid #62988) vectors(Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: ... SUM-159 cells genome edited to express σ2-EGFP [2] and transiently expressing mRuby-CLTB (Addgene; Plasmid #55852) were cultured in F-12 medium with hydrocortisone ...