Labshake search
Citations for Addgene :
101 - 150 of 2767 citations for 7 Bromo 2 3 dihydro isoindol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1-S5E2-jGCaMP6f; Addgene #135632-AAV1; diluted 1:3 in saline) was injected into the RSC (AP ...
-
bioRxiv - Genomics 2022Quote: ... Two gRNAs (one targeting row and one targeting the white gene) was cloned into pCFD4d plasmid (Addgene plasmid #83954) (as described in the protocol “cloning two gRNAs into plasmid pCFD4” ...
-
bioRxiv - Biophysics 2019Quote: ... mTagRFP-T-Mito-7 (mTagRFP-mito, Addgene plasmid # 58023) were gifts from Michael Davidson ...
-
bioRxiv - Neuroscience 2020Quote: ... titer value ≥ 7×1012 vg/ml (Addgene, #59462-AAVrg).
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... plasmid and another population with mEGFP-lifeact-7 (Addgene #58470 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL, Addgene # 114472) or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Cancer Biology 2024Quote: All-in-One-GFP and All-in-One-mCherry plasmids were purchased from Addgene (AIO-GFP #74119 and AIO-mCherry #74120). Their constructions have been described in (22).
-
bioRxiv - Biophysics 2020Quote: ... and EBFP2-Nucleus-7 (nuclear localization signal, Addgene, plasmid #55249), using GenJet transfection reagent (Signagen) ...
-
bioRxiv - Cell Biology 2020Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ...
-
bioRxiv - Cell Biology 2019Quote: mEGFP-Lifeact-7 (gift of Michael Davidson; Addgene plasmid # 54610) was transferred into pCDH-CMV-MCS-EF1-Puro (System Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... together with 2.8 μg of mWasabi-Mito-7 (Addgene #56508) (35 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-CAG-GFP (Addgene, 7×10^12 gc/ml), AAV2-retro-AAV-CAG-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml, Addgene) viruses were injected with a 10μl Neuros syringe (Hamilton ...
-
bioRxiv - Bioengineering 2022Quote: COS-7 cells were transfected with mEmerald-Sec61b-C1 (Addgene #90992 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245 ...
-
bioRxiv - Neuroscience 2020Quote: ... sRed2-Mito-7 and pEGFP-LC3 were obtained from Addgene. DsRed-KDEL was created by inserting an ER retention signal sequence (AAGGACGAGCTG ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126 ...
-
bioRxiv - Cell Biology 2021Quote: ... pmCherry-Lifeact-7 (Addgene #54491, gift from Dr. Michael Davidson) and pcDNA3.1-L1CAM (Addgene # 12307 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ...
-
bioRxiv - Developmental Biology 2022Quote: The following plasmids were used: mCherry-EB3-7 (Addgene 55037), Ect2-GFP (Dehapiot et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-2xML1N (#67797) or mNeonGreen-EB3-7 were from Addgene or Allele Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ...
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Developmental Biology 2019Quote: ... The p3E vector was built by cloning a U6c-gRN(#7)NA#1 fragment (gBlock, IDT) into a KpnI/XhoI site in p3E-MCS (Addgene #75174).
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...