Labshake search
Citations for Addgene :
351 - 400 of 915 citations for 7 Benzyloxy 1H indazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2024Quote: ... A 603 bp long nucleotide encoding for cystatin-7 was cloned into the BamHI/EcoRI sites of pAAV-hSyn-EGFP (# 50465, Addgene) to receive the plasmid pAAV-hSyn-Cst7 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...
-
bioRxiv - Cell Biology 2024Quote: ... The amino acid sequence of bPAC was obtained from pGEM-HE-h_bPAC_cmyc (Addgene plasmid #28134) (Stierl et al ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rpb7 was PCR amplified from HEK293T cDNA with primers to introduce a Shine-Delgarno sequence and a C-terminal 6x-His tag and cloned into the EcoRI and NotI sites of pGEX4T1-Rpb4 using T4 DNA ligase to generate pGEX4T1-Rpb4/7 (Addgene #138484).
-
bioRxiv - Microbiology 2021Quote: ... was synthesized by Integrated DNA Technologies (IDT, Coralville, IA) and cloned into the mEGFP-Lifeact-7 mammalian expression plasmid (Addgene #54610), replacing Lifeact and appending a 3x HA tag ...
-
bioRxiv - Microbiology 2020Quote: RAW 264.7 cells stably expressing FL-Cas9 were generated by transducing RAW 264.7 cells with lentivirus containing LentiCas9-Blast (Addgene plasmid #52962)(Sanjana et al. ...
-
bioRxiv - Neuroscience 2021Quote: U118-MG astrocytoma cells were transfected with the F-actin marker mCherry-LifeAct-7 plasmid (gift from Michael Davidson, Addgene #54491) using a calcium phosphate precipitation protocol.24 LifeAct-7 is a 17 amino acid peptide that binds to the actin cytoskeleton ...
-
bioRxiv - Cell Biology 2019Quote: ... and mCherry CDS was subcloned from the mCherry-Mito-7 vector (Olenych et al., 2007) (a gift from Dr. Michael Davidson, Addgene #55102). The α4-mCherry cassette was inserted between the EcoRI/NotI sites of pCAGGS/ES vector ...
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Developmental Biology 2019Quote: ... The p3E vector was built by cloning a U6c-gRN(#7)NA#1 fragment (gBlock, IDT) into a KpnI/XhoI site in p3E-MCS (Addgene #75174).
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... The full CD3-CD90.2 insert was further subcloned into the pMX vectors with different promoters using BamHI and HindIII (Addgene #163334-7).
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Microbiology 2021Quote: A 2933 bp in vitro DNA synthesized IRES-vpr mKO fragment was ordered from Genewiz (South Plainfield, NJ) using an IRES sequence from pTRIPZ-hDDX5/7 (Addgene Plasmid #71307) (64 ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-mediated gene disruption was performed by identifying individual gRNA sequences with consistent enrichment in LDLlow cells in our previously reported CRISPR screens [7] and cloning these sequences into the BsmBI sites of pLentiCRISPRv2 (Addgene #52961, [43]) or into the BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...