Labshake search
Citations for Addgene :
401 - 450 of 2252 citations for 7 Benzyloxy 10 11 dihydrodibenzo b f 1 4 thiazepin 11 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Nucleus-7 plasmid was generated by Michael Davidson and obtained from Addgene (Addgene plasmid no. 55110). Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126; http://n2t.net/addgene:55126; RRID:Addgene_55126) PH-Btk-GFP was a gift from Tamas Balla (Addgene plasmid # 51463 ...
-
bioRxiv - Biophysics 2020Quote: ... The sequence was then excised with XbaI and HindIII and inserted into pT7-7 plasmid (Addgene #36046) between the XbaI and HindIII restriction sites to generate a plasmid template construct (pT7-fastFISH (pT7-fF)).
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127; http://n2t.net/addgene:55127; RRID:Addgene_55127). Lamp1-RFP62 was a gift from Walther Mothes (Addgene plasmid # 1817 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874; http://n2t.net/addgene:55874; RRID:Addgene_55874). mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 Chrna2-Crewt/wt) were injected bilaterally with 300 nl of AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene, LOT 44361-AAV9 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR editing was performed as described previously2 using Cas9 plasmids pSpCas9(BB)-2A-Puro (PX459) V2.0 (a gift from F. Zhang, Addgene 62988) or pCas9_GFP (a gift from K ...
-
bioRxiv - Cancer Biology 2021Quote: ... MSCV EZH2 ΔSET-Hygro (cat# 49403) EZH2-Y641-F (cat# 80077) and pTRIPZ M)-YFP-EZH2 (cat# 82511) were procured from Addgene USA ...
-
bioRxiv - Plant Biology 2021Quote: ... including a 2385 bp region upstream of the ATG start codon and a 294 bp region downstream of the TAG stop codon was PCR amplified with oligonucleotides MTOPVI-Prom-SalI-F and MTOPVI-Term-NotI-R and cloned between SalI and NotI restriction endonuclease sites into pGreen0029 vector (Addgene), to yield the pGreen-gMTOPVIB construct ...
-
bioRxiv - Biophysics 2020Quote: Murine sarcoma S-180 cells were stably transfected with plasmid construct encoding for F-TRActin-EGFP (Addgene® Plasmid #58473). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cell Biology 2020Quote: Editing of the SFXN1 gene was carried out using the pSpCas9(BB)-2A-GFP CRISPR-Cas9 construct (a gift from F. Zhang; Addgene) (Ran et al. ...
-
bioRxiv - Microbiology 2023Quote: ... We subcloned each of these constructs into the backbone of the lentiGuide-Puro vector (provided by F. Zhang, Addgene #52963)36 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The gRNA oligonucleotides were inserted into the U6>sgRNA(F+E) vector which was a gift from Lionel Christiaen (Addgene plasmid # 59986 ...
-
bioRxiv - Cell Biology 2023Quote: ... Oligonucleotides for cloning guide RNA into pSpCas9 (BB)-2A-GFP vector (48138; a gift from F. Zhang, Addgene, Cambridge, MA) were designed as described previously 63 ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5; http://www.addgene.org/100835/; RRID:Addgene_100835) was a gift of Douglas Kim and GENIE Project ...
-
bioRxiv - Neuroscience 2023Quote: ... For anterograde transsynaptic tracing: AAV1-hSyn-Cre-WPRE-hGH (1013 gc/ml, Addgene; 1:10 dilution) was injected in DCN (coordinates as above) ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre mice were injected with AAV2/8.CAG.Flex.eGFP (Addgene, titer ≥ 1×10¹³ vg/mL) anterograde tracing virus in the HDB (antero-posterior ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Constructs for MRTFA/B silencing and overexpression were gifts from Ron Prywes (Addgene # 27161, #19846, and #27175). To generate inducible expression constructs ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9-Ef1a-DO-hChR2(H134R)-mCherry (gift from B. Sabatini; Addgene plasmid 37082(Saunders et al., 2012); Vigene Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated pAAV-GFAP-GCaMP6m plasmid from flexed-GCaMP6 and pZac2.1-GfaABC1D-mCherry−hPMCA2w/b (Addgene, 111568) and used AAV2/9-pAAV-GFAPGCaMP6m at a concentration of 1.07527E+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA sequences listed in Extended Data Table 7 were cloned into the lentiGuide-Crimson backbone (Addgene Plasmid # 70683). Non-replicating lentiviruses were generated by transient co-transfection of the transfer plasmids into HEK293T together with the packaging plasmids pMDL (Addgene Plasmid #12251) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Genetics 2020Quote: ... followed by incubation of annealed gRNA with 7 pmol of purified Cas9 (made after expression of Addgene #69090) [49] ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160; http://n2t.net/addgene:54160; RRID:Addgene_54160)) ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ; http://n2t.net/addgene:56596 ; RRID:Addgene_56596), EGFP-DCX was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Neuroscience 2023Quote: ... The CMV::tdTomato-Lifeact-7 plasmid (abbreviated Lifeact throughout the manuscript) was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Genetics 2019Quote: ... into the all-in-one lentivirus vector LentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2021Quote: Each pair of sgRNAs cloned into All-In-One (AIO) CRISPR/Cas9 nickase plasmids (#74119, Addgene) and sequences are shown in table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...