Labshake search
Citations for Addgene :
1 - 50 of 1094 citations for 7 Benzothiazolethiol 6 amino 2 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Developmental Biology 2019Quote: ... or the truncation that lacks coding sequence for amino acid 2 to amino acid 180 of Prdm16 was PCR amplified from MSCV-Prdm16 (Addgene 15504) and inserted between the EcoRI and XhoI sites in pCAGIG-NLS-Flag ...
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids mIFP12-Rab4a-7 (#56261) and mIFP-Golgi-7 (#56221) were purchased from Addgene.
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426 ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Genomics 2022Quote: ... Snai1 and Srebf2 to the pINDUCER21 Dox-inducible lentiviral vector (Meerbrey et al. 2011) using the services of Genscript (Addgene #46948, Supplementary Figures 6 and 7). We used the pINDUCER21 system since it allows us to control the level of over-expression of a gene with precision by adding different levels of Doxycycline to the cell growth media ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cell Biology 2019Quote: mPlum-Lifeact-7 (Addgene plasmid # 54679) and mCherry-Sec61 β (Addgene plasmid # 49155 ...
-
bioRxiv - Neuroscience 2020Quote: ... or mCherry-Mito-7 (Addgene #55102) (34 ...
-
bioRxiv - Neuroscience 2021Quote: The plasmid pT7-7 (Addgene 36046)[29] coding for the human α-synuclein wild type (α-syn ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pmTagBFP2-Lifeact-7 (Addgene plasmid #54602) from M ...
-
bioRxiv - Cell Biology 2022Quote: ... mTagRFP-T2-Mito-7 (Addgene #58041) (referred to as mitoRFP in the text) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Microbiology 2021Quote: ... The coding sequence from amino acid 747E to 1061K was amplified by PCR from the pDONR207 SARS-CoV-2 NSP3 plasmid (Addgene, #141257, a gift from Fritz Roth[32]), including a Kozak sequence and ATG start codon in the forward primer and a TAA stop codon in the reverse primer (PLPcd_Fw ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Neuroscience 2023Quote: ... and ectodomain (52-750 amino acids) of the NEP (#7283, Addgene) were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008 ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.
-
bioRxiv - Cell Biology 2020Quote: ... and to link GFP11×7 tag (from Addgene Plasmid #70224 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...