Labshake search
Citations for Addgene :
601 - 650 of 2919 citations for 7 BROMO 1 2 3 4 TETRAHYDROCYCLOPENTA B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... and firefly luciferase control (FLuc) were generated by subcloning FLuc-5Xbox b from plasmid pAc5.1C-Fluc-STOP-5boxb (Addgene) into pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2019Quote: ... Cas9 guide RNA sequences were identified using the website crispr.mit.edu (guide A: gTCCCCGCAAGAGTAGTAAT; guide B: gGTCTCACAGACCGTAAGTT) and inserted into plasmid pX335 (a gift from Feng Zhang, Addgene, 42335). HeLa Kyoto cells (Landry et al. ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transduced overnight at a MOI of 0.4 with a pooled genome-wide CRISPR KO (GeCKO v2) library A or B (Addgene) containing a total of 122,411 sgRNAs (6 sgRNAs per gene ...
-
bioRxiv - Cell Biology 2023Quote: Human genome targeting CRISPR Knock-Out (GeCKO) v2 lentiviral pooled libraries (A and B libraries) were purchased from Addgene and amplified according to a published protocol (Sanjana et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... was designed to target the regions close to the start codon (Figure 1A,B) and the sgRNA sequence was inserted into the pX459 V2.0 plasmid (#62988, Addgene). The reference plasmids containing PA tag sequence were constructed in pBluescript II SK (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL1R1 sgRNA was custom designed against IL1R1 promoter G-quadruplex (G4-motif B) and cloned in pX333 (Addgene 64073) backbone after replacing Cas9 with mCherry.
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µL of 4.6 x 1012vg/mL AAV5-hSyn-DIO-hM4D(Gi)-mCherry (UNC Viral Vector Core; (Krashes et al., 2011)) or 7 x 1012vg/mL AAV5-hSyn-DIO-mCherry (Addgene) was injected at 2.1 mm below the surface of the brain (Andrews-Zwilling et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... CRF1-cre mice were injected with 500 nL/hemisphere of AAV5-hSyn-DIO-eGFP (50457-AAV5; titer ≥ 7×10¹² vg/mL, Addgene) into the VTA (ML ±0.60 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #37825-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #29777-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... unilateral injections of 50-70 nL AAV5-CAG-ArchT-GFP (titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #29777-AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 603 bp long nucleotide encoding for cystatin-7 was cloned into the BamHI/EcoRI sites of pAAV-hSyn-EGFP (# 50465, Addgene) to receive the plasmid pAAV-hSyn-Cst7 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...