Labshake search
Citations for Addgene :
351 - 400 of 467 citations for 7 8 Dihydro 6 5H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... DAT-Cre+/- / SERT-Flp+/- mice were injected with 500 nL of either AAV-DJ-ef1a-DIO-ChR2-eYFP or AAV-DJ-ef1a-DIO-eYFP bilaterally into the VTA and 1000 nL of AAV-8-nEF-CoffFon-NpHR3.3-eYFP (Addgene #137154) or AAV-DJ-ef1a-fDIO-eYFP into the DR and implanted bilaterally with optical fibers in the NAc medSh ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Suppl. Table 8) in the BbsI restriction sites of pX459 (#62988, Addgene). In brief ...
-
bioRxiv - Neuroscience 2023Quote: AAV serotype 8 viral vectors encoding for floxed EGFP under the synapsin promoter (pAAV-hSyn-DIO-EGFP (#50457)) were purchased from Addgene. rAAV-PV-EGFP-bGH polyA and rAAV-PV-CRE-EGFP-bGH polyA encoding for EGFP under the PV promoter were purchased from BrainVTA ...
-
bioRxiv - Biochemistry 2024Quote: ... AriB or AriA-AriB were cloned into an arabi-nose-inducible UC Macrolab vector 8-B (Addgene #37502; ampicillin-resistant) and Ocr was cloned into an IPTG-inducible pTrc99A-based vector (kanamycin-resistant) ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2020Quote: 8 weeks old Mrap2fl/fl Mc4regfp females (n=4) were injected unilaterally with pAAV-Ef1a-mCherry-IRES-CRE (Addgene, catalog #55632-AAV8).
-
bioRxiv - Genetics 2020Quote: ... Male mice at ages 8-12 weeks were Jugular vein injected with 1011 particles of AAV expressing either Cre recombinase (Addgene 107787-AAV8) or GFP (Addgene 105535-AAV8 ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pAR-Ec611 (ArEc-Rev1-611) plasmid harboring medium-error-rate polymerase TP-DNAP1_611 (≥10−6 s.p.b.) was obtained from Addgene (Watertown, MA).
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene-26236) (Pfeiffer et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...