Labshake search
Citations for Addgene :
201 - 250 of 2939 citations for 7 Diethylamino 3 ethylamino 2 methylphenoxazin 5 ium tetrachlorozincate 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR223 SARS-CoV-2 NSP2 (Addgene, 141256) and expression clones with N-terminal fusion tags were produced simply by Gateway cloning (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR207 SARS-CoV-2 NSP1 (Addgene, 141255), pDONR223 SARS-CoV-2 NSP2 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (2 µg; Addgene, Cat# 12260) were co-transfected with lentiviral expression construct (3 µg ...
-
bioRxiv - Genomics 2023Quote: ... and pMDG.2 (envelope vector; Addgene #12259) with the TKOv3 lentiCRISPR plasmid library [59] ...
-
bioRxiv - Neuroscience 2023Quote: ... ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246), and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Genomics 2019Quote: The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2019Quote: Mice 5-7 weeks old received bilateral microinfusion of AAV1-CamKiia-hChR2(H134R)-mCherry.WPRE.hGH (Addgene, #26975-AAV1) layer 2/3 of the barrel cortex (−1.3mmAP ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.