Labshake search
Citations for Addgene :
351 - 400 of 3145 citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCTCGTTCAGCACGGCCTCCA and reverse 5’- aaacTGGAGGCCGTGCTGAACGAGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987). To knock in eGFP into either the MFF or FIS1 loci ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCATTTAAATACAGTAAATAC and reverse 5’- aaacGTATTTACTGTATTTAAATGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987)10.
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein-coding sequence was codon optimized and flanked by HindIII (5’) and NotI (3’) restriction sites for cloning into a pCMV plasmid (Addgene #60360). A hemagglutinin (HA ...
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Developmental Biology 2019Quote: ... The p3E vector was built by cloning a U6c-gRN(#7)NA#1 fragment (gBlock, IDT) into a KpnI/XhoI site in p3E-MCS (Addgene #75174).
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-E-Syt1 was a gift from Pietro De Camilli (Addgene plasmid # 66830) (41) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli DH10B-ALT (E. coli DH10B modified to constitutively express araC, Addgene, #61151) and are listed in Table S1 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.75 µL of rgAAV-FLEX-tdTomato (diluted 1:3 in dPBS; Addgene number: 28306) was injected in TH-Cre mice in basal forebrain (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Cell Biology 2019Quote: ... mRuby-Lifeact-7 was a gift from Michael Davidson (#54560, Addgene). One day after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and EBFP2-Nucleus-7 (Addgene #55249, a gift from Michael Davidson). The targeting sequences for the nucleus ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Cell Biology 2020Quote: ... and mCherry-Cx43-N-7 were gifts from Michael Davidson (Addgene plasmids # 55112 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene, 54491).
-
bioRxiv - Cell Biology 2022Quote: ... The mCherry-EB3-7 vector was obtained from Addgene (addgene #55037) and the mCherry was removed and replaced by a GFP sequence using AgeI/BsrG1 restriction enzymes ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018 ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.