Labshake search
Citations for Addgene :
401 - 450 of 3904 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Bioengineering 2021Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Systems Biology 2022Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2023Quote: pMD2.G (Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... a VSV-G envelope-expressing plasmid pMD2.G (Addgene plasmid #12259), and the packaging plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... and the VSV-G envelope plasmid PMD2.G (Addgene Plasmid #12259). 48 hours after transfection ...
-
bioRxiv - Immunology 2019Quote: ... and VSV-G-expressing envelope plasmid pCMV-VSV-G (8454, Addgene) were transfected into HEK293 T cells using jetPRIME transfection reagent (114-15 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the VSV-G envelope plasmid pMD2.G (plasmid #12259, Addgene) from Didier Trono (Ecole Polytechnique Fédérale de Lausanne ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 500 ng of pMD2.G (VSV-G) (Addgene plasmid #12259), using Lipofectamine 2000 at a ratio of 1:2.5 (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and VSV-G envelope expressing plasmid PMD2.G (Addgene, plasmid #12259) were gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and VSV-G envelope (pMD2.G, gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... 1.5 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 1.5 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.5 µg VSV-G envelope plasmid (pMD2.G, Addgene #12259) into HEK293T cells in 57 µL Opti-MEM and 6 µL FuGENE HD (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... the pMD2.G plasmid encoding the VSV-G envelope (Addgene #12259), and the psPAX2 packaging plasmid (Addgene #12260 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and hAHRΔe8-9 sequences were cloned in a lentiviral plasmid (Addgene #52961) and subsequently to pcDNA3.1 vector with the In-fusion HD Eco-dry cloning (Takarabio) ...
-
bioRxiv - Cell Biology 2021Quote: ... We used TALENs targeting exon 9 of RBM20 (Addgene #108342 and #108343) to generate the RBM20 R636S Het iPSC line ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV-Ef1a-DIO eNpHR3.0-EYFP (serotype 9) were purchased from Addgene. The plasmids of AAV[shRNA]-CMV>mCherry-U6>Scramble_shRNA (serotype 9) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Molecular Biology 2019Quote: The HIV-derived construct pNL4-3(eGFP)(NL4-3 RRE)(TagBFP) (pHR5580) was packaged and VSV-G pseudotyped using a transient second generation packaging system including psPAX2 (Addgene plasmid 12260, pHR5691) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Genetics 2023Quote: ... 2 X 106 cells were co-transfected with 10 µg pT077 (Addgene 137879), 1.5 µg AAVS1 TALEN L (Addgene 59025 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961) were produced in 293T cells as previously described18 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-Syn-Chronos-GFP (Chronos, 2.90e+13 gc/mL, 250 nL, Addgene #59170-AAV1), AAV-syn-FLEX-jGCaMP7b-WPRE (FLEX-GCaMP7b ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.