Labshake search
Citations for Addgene :
601 - 650 of 3074 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...
-
bioRxiv - Genetics 2019Quote: ... 4 μg of pMD2.G plasmid (Addgene), and 8 μg of psPAX2 (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Insulin in pX330S-4 (Plasmid #58780, Addgene) and Glut2 in pX330S-5 (Plasmid #58781 ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Immunology 2019Quote: ... pCMV-DR8.2 (5 ng, Addgene #12263) and 2.5 μg of the lentiviral vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...