Labshake search
Citations for Addgene :
1 - 50 of 3280 citations for 6 chloro 2 N 2 N diethyl 4 N propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ; http://n2t.net/addgene:57461; RRID:Addgene_57461). CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ...
-
bioRxiv - Biophysics 2022Quote: ... NCBI Accession YP_009820873.1) were cloned with an N-terminal TEV protease-cleavable His6-tag using UC Berkeley Macrolab vector 2-BT (Addgene #29666). Truncations and other modified constructs were cloned by PCR mutagenesis and isothermal assembly ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro (a kind gift from Neven Krogan, available from Addgene #141391) with PEI ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transiently co- transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and GFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Bioengineering 2021Quote: ... the sequence encoding the PE2 N terminus (PE2-N term) (Addgene #132775) and a splicing donor (SD ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 5; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cancer Biology 2021Quote: ... N-Myc (Addgene #74163) was cloned into plasmid pcDNA5/FRT/TO (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797) (Nabet et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3-N-HA-NEK7 and pcDNA3-N-HA-NEK7K64M were gifts from Bruce Beutler (Addgene plasmid # 75142 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Plant Biology 2020Quote: ... pAG426GAL_eGFP_ccdB (Addgene; N-terminal GFP fusions) or pAG426GAL_ccdB_eGFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: The pcDNA3-Shh (N) (Addgene, #37680) was used as template to amplify the cDNA coding residues 24-197 of mouse Shh ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340 ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3-N-Flag-ASC1 (Addgene, #75134) plasmid was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The N-terminus fusion plasmid pDN0605 was constructed using pDEST-DHFR F[1,2]-N (TRP1) (Addgene #177797) (Evans-Yamamoto et al ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...