Labshake search
Citations for Addgene :
401 - 450 of 529 citations for 6 TERT BUTYLQUINOLINE 98.0+% GC T since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Physiology 2022Quote: ... 60% confluent monolayers of 293-T cells were transfected with LV shuttle vector pUltra-hot-LT and the packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: The plasmids for Dox-inducible expression of the ddGFP PAR-T constructs were generated using a cDNA for ddGFP-A (Addgene, 40286) or ddGFP-B (Addgene ...
-
bioRxiv - Biophysics 2022Quote: For biolayer interferometry experiments protease 2A from CV-B3 was sub-cloned into LIC cloning vector 2Bc-T (Addgene plasmid # 37236) with a C-terminal His6-tag ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Plant Biology 2020Quote: ... FolSIX418-242 and FolSIX617-225) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The delCTCF(CS38) and inv(T-DOM) alleles were generated after cloning the gRNAs into the pX330:hSpCas9 (Addgene ID 42230) vector and DNA injection into pronuclei ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... N3 (residues 365-419) was similarly inserted into UC Berkeley Macrolab vector 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Biochemistry 2023Quote: ... The PrcA and PrcB genes were sub-cloned in the pET His6 TEV LIC cloning vector (2B-T, a generous gift from the Scott Gardia lab) (Addgene# 29666) and pET His6 TEV LIC cloning vector (2A-T ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 TAD (13-61) were subcloned into the pET His6 GST TEV LIC cloning vector (2G-T) (a gift from Scott Gradia, Addgene plasmid #29707) and transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 DBD (94-312) were subcloned into the pET His6 TEV LIC cloning vector (2B-T) (a gift from Scott Gradia, Addgene plasmid #29666) and transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding a fragment of human Archease (Uniprot Q8IWT0) spanning residues 27−167 was cloned into the UC Berkeley MacroLab 2M-T vector (gift from Scott Gradia, Addgene plasmid #29708) to express a fusion protein containing an N-terminal His6 tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The obtained pGEM-T-RBM8A plasmid was cleaved with Sfi I and subcloned into the Sfi I site of pSBtet-GP vector (Addgene, Watertown, MA, USA) [25].
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088; http://n2t.net/addgene:14088; RRID:Addgene_14088; a gift from William Hahn) as previously described (13) ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The plasmid for tagging the N-terminus of the human lamin B1 gene (LMNB1) with RFP was purchased from Addgene (LMNB1-mTagRFP-T, #114403). The plasmid sequence was validated by Sanger sequencing.