Labshake search
Citations for Addgene :
501 - 550 of 2085 citations for 6 Pyrrolidin 1 yl Pyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746; http://n2t.net/addgene:107746; RRID:Addgene 107746) [32] ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Genetics 2021Quote: ... the cassette containing the C terminus half of the DddAtox (split at 1397 amino acid position) and UGI was amplified from the DdCBE plasmid (Addgene plasmid no. 157844). The PCR amplicon was digested with XbaI and BsU36I restriction enzyme and cloned in the pkTol2c-FusXTBE-N vector linearized with XbaI and Bsu36I to generate pkTol2c-FusXTBE-C plasmid ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids: 0.5×106 target cells were cultured in 6-well plates and transfected with pEGFP-SKL (Addgene#53450 from Jay Brenman Lab) plasmids using TurboFect Transfection Reagent (Thermo-Scientifics R0531 ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were plated at 70-80% confluence in 6 well plates and transfected with 1μg of each plasmid containing 7a and 7b sgRNAs (Addgene #113620 and #113624) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: The B-cell acute lymphoblastic leukemia cell lines NALM-6 and REH were lentivirally transduced with plasmid expressing Cas9 nuclease (LentiCRISPR V2; Addgene Plasmid #52961) as described below at a MOI of 0.5 ...
-
bioRxiv - Neuroscience 2021Quote: Mice anaesthetized using isoflurane were bilaterally infused with pAAV2-hSyn-DIO-hM3D(Gq)- mCherry (≥ 6 × 1012 vg/mL; Addgene #44361, Lot v58216). After exposing the skull and creating small <2mm bilateral holes with a dental drill (Stoelting ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Neuroscience 2023Quote: ... were designed to target CEP290 exon 6 and cloned into the pSpCas9(BB)-2A-GFP (PX458; gift from Feng Zhang; Addgene plasmid #48138). RPE1 cells were transfected with this plasmid by using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described59 ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328; http://n2t.net/addgene:19328; RRID:Addgene_19328); 100 ng/µl of a construct expressing Cas9 and a sgRNA targeting the sequence ACATGAGTCTGTGTTTACGG (derived from pDD162 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... table 3 for sgRNA sequences) together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’UTR sequence of histone H1 sequentially into the backbone vector pFGL822 (Addgene #58225, Basta resistance); pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081 ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...