Labshake search
Citations for Addgene :
1 - 50 of 2683 citations for 6 Oxabicyclo 3.1.0 hexan 2 ol 4 tetrahydro 2H pyran 2 yl oxy 1R 1 α 2 bta 4 α 5 α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for α-actinin-2-ABD was obtained from Addgene (RefSeq: NM_001103.3, Plasmid ID 52669) and PCR amplified using the forward primer AAACACCTGCAAAAAGGTATGAACCAGATAGAGCCCGGC and reverse primer AAATCTAGATTACTCCGCGCCCGCAAAAGCGTG ...
-
bioRxiv - Cell Biology 2019Quote: ... α-actinin-tagRFP was generated by replacing mEOS3.2 from α-actinin-mEOS3.2 (Addgene 57444) with the tagRFP sequence from ptagRFP-N1 using AgeI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biochemistry 2020Quote: ... The Vn-α-syn (Addgene plasmid #89470 ...
-
bioRxiv - Biochemistry 2020Quote: ... and α-syn-Vc (Addgene plasmid #89471 ...
-
bioRxiv - Neuroscience 2020Quote: ... pmCherry-α-tubulin (Addgene 21043) and EB1-EGFP (Addgene 39299 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid EGFP-α-SynA53T (Addgene plasmid #4082338 ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP-α-synuclein (Addgene construct #40822), EGFP-α-synuclein A53T (Addgene construct #40823) ...
-
bioRxiv - Neuroscience 2022Quote: ... EGFP-α-synuclein-WT (Addgene #40822), and EGFP-α-synuclein-A53T (Addgene #40823) ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type α-syn (Addgene, 3604628) was expressed and harvested from Escherichia coli as described previously29 ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Neuroscience 2021Quote: ... Control (DATIREScre) neurons and α-syn overexpressing neurons (DATIREScre/α-syn) were transduced with AAV1-LoxP-tdTomato (Addgene) on DIV5 ...
-
bioRxiv - Biophysics 2023Quote: ... 37] was used to generate the α-catenin DVBS in α-catenin KO cell line (Addgene plasmid 178649).
-
bioRxiv - Cell Biology 2020Quote: ... α-synuclein-GFP was obtained from Addgene. Plasmids encoding αsyn-L1 or αsyn-L2 have been described elsewhere 20,21.
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... hyperacetylated α-Tubulin (K40Q-eGFP, Addgene 105302); and hypoacetylated -Tubulin (K40R-eGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... hyperacetylated α-Tubulin (K40Q-eGFP, Addgene 105302); and hypoacetylated -Tubulin (K40R-eGFP ...
-
bioRxiv - Neuroscience 2022Quote: ... and EGFP-α-synuclein-A53T (Addgene #40823). BSA conjugates included BSA-488 (Thermo Fisher Scientific/Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP-α-synuclein A53T (Addgene construct #40823), α-synuclein-HA in pHM6.
-
bioRxiv - Neuroscience 2023Quote: EF1-α promoter from pLVTHM (Addgene # 12247) was used to replace the CMV promoter in pAAV.U6.shRLuc.CMV.ZsGreen.SV40 (Penn Core Vector ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... Templates for WT α-Tubulin-GFP (Addgene 56450); hyperacetylated α-Tubulin (K40Q-eGFP ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... and α-SYN (wt)-141C (Addgene ID #108866) with a cysteine residue at C-terminus ...
-
bioRxiv - Neuroscience 2023Quote: ... and α-syn 96-110 Scr (Addgene #213503) were expressed in Escherichia coli BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Synthetic Biology 2021Quote: ... and pACUH-GFP11×7-mCherry-α-tubulin (Addgene: 70218)39.
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: The human α-SYN wild-type (Addgene ID #36046) and α-SYN (wt)-141C (Addgene ID #108866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald α-Catenin plasmid was purchased from Addgene (#53982). To obtain clones that express GFP N-Cadherin or mEmerald α-Catenin ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Cell Biology 2024Quote: ... We acquired wild-type α-syn/pET21a (Addgene 51486) courtesy of the Michael J ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Cell Biology 2021Quote: ... and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid EGFP-α-SynA53T (Addgene plasmid #4082338; http://n2t.net/addgene:40823; RRID:Addgene_40823) was used for expression in SH-SY5Y cells (gift from David Rubinsztein).
-
bioRxiv - Biochemistry 2020Quote: ... and α-syn-Vc (Addgene plasmid #89471; http://n2t.net/addgene:89471; RRID:Addgene_89471) plasmid fragments were both previously cloned into the backbone of pcDNA3.1 under the control of a CMV promoter and were a kind gift of Tiago Outeiro ...
-
bioRxiv - Biochemistry 2020Quote: ... The Vn-α-syn (Addgene plasmid #89470; http://n2t.net/addgene:89470; RRID:Addgene_89470) and α-syn-Vc (Addgene plasmid #89471 ...
-
bioRxiv - Biochemistry 2022Quote: pT7-7 WT α-syn construct (Addgene, USA, gifted from Hilal Lashuel [34]), was transformed into BL21-Gold (DE3 ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... Vinculin-mApple and α-actinin1-TagRFP-T were all gifts from Michael Davidson (Addgene plasmids #54668 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids encoding HA-Ubiquitin (18712) and GFP-α-synuclein A53T (40823) were obtained from Addgene. A FLAG-BRIC6 plasmid was a gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4×105 HEK 293T cells were transfected with pCDH-EF1-sCTLA-4 expression plasmid (1.5 µg) and psPax2 (2 µg) and pMD2.G (1.5 µg) packaging plasmids (Addgene), using Viafect™ (Promega ...