Labshake search
Citations for Addgene :
451 - 500 of 1910 citations for 6 Oxa 7 azatricyclo 3.3.0.02 4 oct 7 ene 8 1 methylethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequence (5’-TGAAAGCCACCAGACCTCGA) targeting exon 8 of the murine leptin receptor (LepR) was ligated into the BsmBI site in lentiGuide-Puro (Addgene 52963) with compatible annealed oligos to generate lentiGuide-Puro-sgLepR ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-12 weeks old Ucn3::Cre male mice were stereotaxically injected with pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA vectors for each given condition (OE, KO, NT) were pooled and co-transfected with pAdH helper plasmid and pAAV2/8 capsid (Addgene, #112864) with polyethylenimine (PEI) ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Genetics 2020Quote: ... Male mice at ages 8-12 weeks were Jugular vein injected with 1011 particles of AAV expressing either Cre recombinase (Addgene 107787-AAV8) or GFP (Addgene 105535-AAV8 ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... Rab7a with a point mutation at residue 8 from leucine to alanine (L8A) was cloned into pEmerald-C1 (Addgene#54734, Davidson Lab) at XhoI-BamHI sites by Genscript ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pAR-Ec611 (ArEc-Rev1-611) plasmid harboring medium-error-rate polymerase TP-DNAP1_611 (≥10−6 s.p.b.) was obtained from Addgene (Watertown, MA).
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Cell Biology 2020Quote: ... 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene-26236) (Pfeiffer et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2023Quote: BMDMs grown on 4-well chamber were transfected with GEM-CEPIA1er (Addgene) (Suzuki et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was cloned by generating PCR fragments from the pTetQCas-8+IS186 and the pTnsABC construct (gift from Sheng Yang (Addgene plasmid # 170636; & #1306331)) using the GeneArt™ Gibson Assembly HiFi Master Mix (InvitrogenTM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... annealed oligonucleotides (Supplementary Table 6) were cloned into a BsaI site of a gRNA expression vector (Addgene Plasmid number 41824) 65 and correct insertion was determined by Sanger sequencing with the SP6 primer (Supplementary Table 6) ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid containing codon-optimized GAL80 sequence driven by a tubulin promoter is a gift from Allison Bardin and corresponds to the combination of pattB-tubP-SV40 - generated by Lee and Luo (Lee and Luo, 1999)-with the codon optimized GAL80 sequence from pBPGAL80Uw-6-a gift from Gerald Rubin (Addgene plasmid #26236 ...
-
bioRxiv - Neuroscience 2022Quote: ... between the age of P60 and P120 (n = 6) were injected with virally encoded Cre-dependent GCaMP in PFC (~300 nl, AAV2/9 flex GCaMP6f, Addgene) and Cre in LEC (140 nl at each site ...