Labshake search
Citations for Addgene :
51 - 100 of 2566 citations for 6 Methylimidazo 2 1 b thiazole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... PMCA2w/b and GCamP6s (both from Addgene); and DsRedExpress2 (Clontech) ...
-
bioRxiv - Molecular Biology 2022Quote: ... B-HiFi SpCas9 (#) HypaR-SpCas9 (Addgene #126757), B-HypaR-SpCas9 (Addgene #126764).
-
bioRxiv - Cell Biology 2023Quote: ... and pUC57-b-globin (Addgene plasmid 194437) have been deposited at Addgene.
-
bioRxiv - Microbiology 2023Quote: ... and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFPC1-hVAP-B KD/MD (Addgene – 104450), pEFIRES-P-mTagBFP-KDEL (Addgene – 87163 ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ; http://n2t.net/addgene:111568 ; RRID:Addgene_111568) with primers designed to incorporate a N-terminal HA tag encoding the amino acids YPYDVPDYA and used to replace mCherry-PMCA2w/b in the same backbone at the 5’ NheI and 3’ XbaI restriction sites using the NEBuilder Hifi DNA assembly kit ...
-
bioRxiv - Bioengineering 2021Quote: ... and B-GECO was also obtained from Addgene. MaLionG and mitoMaLionR were generated in the author’s group (T ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... 2017 #6} (Addgene, Cat#1000000115), and verified by PCR ...
-
bioRxiv - Physiology 2023Quote: ... 6 μg of psPAX2 (Addgene), and 15 μg of pLV6-BMAL1-Luc vector (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and pSH-EFIRES-B-Seipin-miniIAA7-mEGFP (Addgene #129719) [3,10] ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...