Labshake search
Citations for Addgene :
251 - 300 of 2860 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazole 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... the two fragments of FlipGFP B1-9 and B10-E5-B11-TEVcs-K5 were amplified from Addgene Plasmid #124429 via PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Microbiology 2021Quote: ... The coding sequence from amino acid 747E to 1061K was amplified by PCR from the pDONR207 SARS-CoV-2 NSP3 plasmid (Addgene, #141257, a gift from Fritz Roth[32]), including a Kozak sequence and ATG start codon in the forward primer and a TAA stop codon in the reverse primer (PLPcd_Fw ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The single vector mammalian expression system containing a CAG promoter-driven St1Cas9 LMD-9 and its U6-driven sgRNA (U6_sgRNA_CAG_hSt1Cas9_LMD9; Addgene plasmid #110626) was built from the above-described plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The U6-driven sgRNA expression cassettes for St1Cas9 (LMD-9) (v1, v2, v3) (St1Cas9_LMD-9_sgRNA_pUC19; Addgene plasmid #110627) were synthesized as gBlock gene fragments (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Synthetic Biology 2019Quote: We modified the vector pX330A_dCas9–1 × 4 (a gift from Takashi Yamamoto, Addgene plasmid #63598) by inserting a gBlock Gene Fragment (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...