Labshake search
Citations for Addgene :
601 - 650 of 651 citations for 6 Methy 1H indazol 5 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Plant Biology 2023Quote: ... The construct contains a Cas9 expression cassette driven by the CaMV 2×35S promoter and 5’UTR and guide RNA (Ueta et al. 2017) scaffold driven by the AtU6 promoter (Kamoun Lab, Addgene #46968). The AtU6-gRNA-7xT fragment was cloned into level-1 plasmid (SlIAA9-gRNA3 ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... The guide RNA targeting sequence 5’- TGGTCGTGGATACGAGAAGA-3’ was inserted into the Peft-3>Cas9 + sgRNA plasmid pDD162 [12] (Addgene #47549) using a Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Two gRNA spacer sequence targeting the 5’UTR immediately before the start codon of gcm were first cloned into pAC-U63-tgRNA-nlsBFPnls (Addgene 169029) (78 ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein-coding sequence was codon optimized and flanked by HindIII (5’) and NotI (3’) restriction sites for cloning into a pCMV plasmid (Addgene #60360). A hemagglutinin (HA ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Neuroscience 2019Quote: ... AAVrg-CAG-GFP (titer: 5×1012 vg/mL, this construct was a gift from Edward Boyden to Addgene-viral prep # 37825-AAVrg) and AAVrg pmSyn1-EBFP-Cre (titer ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected for lentiviral production in media containing 5 μg of each lentiviral packing plasmid (pMD2.G and psPAX2, Addgene: #12259, #12260, respectively), 10 μg of the scramble pLKO.1 or the NNT constructs (named here 1 and 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2021Quote: ... and four mice (control group) were stereotactically injected in the DR with AAV2/5-EF1α-DIO-WPRE-eYFP (Addgene viral prep 27056-AAV5) at a rate of 75 nl per min using surgical procedures (anesthesia ...
-
bioRxiv - Molecular Biology 2023Quote: The 5’ UTR of CCND2 mRNA was cloned into the pGL3-TK-5UTR-BsmBI-Luciferase reporter plasmid purchased from Addgene (https://www.addgene.org/114670/). The DNA fragment was amplified from cDNA prepared from HEK293T using primers with the extra 5’ end corresponding to the BsmbI cut sites in the plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...