Labshake search
Citations for Addgene :
51 - 100 of 3022 citations for 6 METHYL 2 OXO 4 THIOPHEN 2 YL 1 2 3 4 TETRAHYDRO PYRIMIDINE 5 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Developmental Biology 2019Quote: ... or the truncation that lacks coding sequence for amino acid 2 to amino acid 180 of Prdm16 was PCR amplified from MSCV-Prdm16 (Addgene 15504) and inserted between the EcoRI and XhoI sites in pCAGIG-NLS-Flag ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... into pPD132.102 (pmyo-2, #1662, Addgene) via restriction with BamHI and EcoRI ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...
-
bioRxiv - Immunology 2021Quote: ... 2 µg PMD2G plasmids (12259, Addgene), 40 µL of P3000 Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µL of plasmid (#JS825, Addgene) was diluted in 200 µL Xfect transfection reagent (631317 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 μg psPAX2 (#12260, Addgene) packaging plasmid by using polyethylenimine (Xiang et al ...
-
bioRxiv - Microbiology 2022Quote: ... or 2-AT (Addgene #29665; untagged).