Labshake search
Citations for Addgene :
701 - 750 of 2747 citations for 6 Isoquinolinol 1 2 3 4 tetrahydro 1 4 methylphenyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin; Addgene cat no.18803). Scramble siRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pXL002-ishRNA-beta-catenin-1 (Addgene, #36297) and pXL004-ishRNA-scramble (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... pLKO.1 neo was provided by Sheila Stewart (Addgene plasmid # 13425 ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 1-K44A-mRFP was purchased from Addgene (#55795). Dynamin 2-mTFP1 (or dynamin 1-mTFP1 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following plasmids were obtained from Addgene (Table 1). Striatal neuronal cells seeded in 35 mm glass bottom dishes or other plates were transfected 24 h later with cDNA constructs using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: The shRNA/pLOK.1 targeting rictor (plasmid #1853, Addgene) and the control scrambled shRNA (plasmid #1864 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLenti CMV Neo DEST (705-1) (Addgene plasmid # 17392) and pLenti CMV Puro (w118-1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti CMV Puro (w118-1) (Addgene plasmid # 17452) were gifts from Eric Campeau and Paul Kaufman30 ...
-
bioRxiv - Developmental Biology 2021Quote: 1 µg of R26P-M2rtTA targeting vector (Addgene, 47381) and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... and pMA122 (peel-1 negative selection; plasmid 34873; Addgene) into unc-119(ed3 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1 ...
-
bioRxiv - Cancer Biology 2021Quote: A modified pLKO.1 lentiviral vector (Addgene plasmid #27994), in which the puromycin marker gene was replaced by eGFP (for knockdown experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... A mixture with 1 µg VSV-G (Addgene, 8454), 1 µg psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids used: pLKO.1 - TRC cloning vector (Addgene, # 10878)42 ...
-
bioRxiv - Biophysics 2020Quote: ... coli is pJCSUP35NM (1-253) (Addgene Plasmid number #1089). The over-expression of Sup35NM was induced using 1 M IPTG ...
-
bioRxiv - Genetics 2022Quote: ... and 1 µg VSV-G envelope plasmid (Addgene #8454) using 100 µL PEI in 1 mL serum-free DMEM and incubated at room temperature for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Microbiology 2021Quote: ... PLKO.1 TRC cloning vector was purchased from Addgene (gift from David Root ...
-
bioRxiv - Neuroscience 2020Quote: ... We injected 1 µl of AAV1 Syn::GCaMP6s (Addgene) at a titer of 1x1013 vg/mL in the auditory cortex of wild-type mice ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 μl of AAV-CaMKIIa-eGFP (Addgene, #50469-AAV5) virus was injected bilaterally using a 10 μl nanofil syringe (World Precision Instruments ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 and pWPXLd plasmids were purchased from Addgene. shRNAs against Trp53 ...
-
bioRxiv - Physiology 2021Quote: ... the pLKO.1 cloning plasmid was obtained from Addgene, USA (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-479) 3x FLAG (Addgene # 74262) were a gift from Anjana Rao ...
-
bioRxiv - Immunology 2021Quote: ... and HIV-1- gag-pol helper plasmid (pspax2, Addgene) using Lipofectamine 3000 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and AdEasier-1 cells (#16399) were purchased from Addgene. Full length Rela gene was inserted into pShuttle-CMV with SalI and NotI to obtain pShuttle-CMV-Rela ...
-
bioRxiv - Cell Biology 2021Quote: The pLKO.1-Puro plasmid was purchased from Addgene. Small hairpin RNAs were cloned for generation of knockdown constructs (shRNAs ...
-
bioRxiv - Neuroscience 2023Quote: We used the pLKO.1 vector (Addgene plasmid 10878)7 for expression of shRNA against rat Sirt3 (target ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8m-WPRE (Addgene, 2.0E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-SF-iGluSnFR.A1848 (Addgene, 3E12 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8s-WPRE (Addgene, 2.8E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene, catalog #105541-AAV9) bilaterally into the dorsal hippocampus (injection rate ...
-
bioRxiv - Microbiology 2022Quote: ... the pLKO.1-TRC cloning vector (Addgene plasmid 10879) was digested with EcoRI and AgeI to release a 1.9kb stuffer ...
-
bioRxiv - Cell Biology 2022Quote: ... melanogaster KHC residues 1-559 (adapted from Addgene #129761), the Kin2 construct consists of the M ...
-
bioRxiv - Immunology 2023Quote: ... A scramble shRNA-expressing pLKO.1 (Addgene Plasmid #1864) was used as control (shScr) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shFF was cloned into pLKO.1-puro (Addgene #8453). For tet-inducible shRNA knock-down system ...