Labshake search
Citations for Addgene :
51 - 100 of 2827 citations for 6 Fluoro 2 3 dihydro 4H 1 benzothiopyran 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An all-in-one Cas9/gRNA expression construct by cloning an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene #129727) downstream of the hU6 promoter in a PX458 (Addgene #48138 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pRSV-Rev (at a ratio of 4:1:1:1, Addgene#12259, #12251, #12253)41 into HEK293T cells ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
bioRxiv - Microbiology 2023Quote: ... One copy of mKate2 (Addgene #68441) was fused to a strong promoter from the Anderson collection (Table 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2023Quote: Trh-Cre mice of age 2-3 months were injected with AAV1-hSyn-Flex-GCaMP6s (Addgene, 100845). More than 3 weeks after surgery ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/6 (Addgene #110660), pAAV2/6m (20) ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and one ug pMD2.G (Addgene #12259) into a 10-cm dish of 293FT cells (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...