Labshake search
Citations for Addgene :
151 - 200 of 422 citations for 6 ETHYL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids used in this work are listed in Supplementary Table 6 and are available from Addgene (identifiers listed in Supplementary Table 6).
-
bioRxiv - Cancer Biology 2021Quote: ... A doxycycline-inducible Cas9 clonal cell line of NALM-6 (using plasmid pCW-Cas9, Addgene #50661) was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 µg psPAX2 and 3.6 µg pMD2G (gift from the Trono lab, Addgene #12259 and #12260) packaging plasmid using CalPhos Mammalian Transfection Kit (Takara) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ir21a-Gal80 was created by subcloning the Ir21a promoter region into pBPGAL80Uw-6 (Addgene plasmid # 26236) [28 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with ∼2000 nl of a 1:6 ratio of AAV1-Syn-Cre (AAV.hSyn.Cre.WPRE.hGH, 105553-AAV1, Addgene) and AAV1-CAG-tdTomato (59462-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Tau fragments were subcloned into pcDNA3.1 by restriction digestion and further into pCW57.1- MAT2A all-in-one tet-off lentiviral backbone (a gift from David Sabatini (Addgene plasmid # 100521))71 by Gibson assembly ...
-
bioRxiv - Molecular Biology 2022Quote: U-2 OS CRISPR knockout lines were generated using the All-in-One plasmid encoding dual sgRNAs and fluorescent protein-coupled Cas9D10A nickase (AIO-GFP; Addgene #74119) (Chiang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2 vector (Addgene #87360). sAC-targeted sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNMT3B shRNAs were cloned into Tet-ON all- in-one plasmids LT3GEPIR (gift from Johannes Zuber, Addgene Plasmid #111177, RRID:Addgene_111177) and LT3REPIR (same as LT3GEPIR except for GFP being substituted with dsRed ...
-
bioRxiv - Physiology 2020Quote: ... Mice were injected in each side or one side of the DMH with ∼0.5 µL AAV2-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, Cambridge, USA), AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene) ...
-
bioRxiv - Genetics 2020Quote: ... All-in-one-plasmids encoding both Cas9 and the desired sgRNA were created by site-directed mutagenesis of pDD162 (Addgene #47549) (Dickinson et al ...
-
bioRxiv - Cell Biology 2022Quote: ... the same procedure was conducted to create and quantify the one-vector format Brunello human CRISPR knockout pooled library (Addgene #73179,59).
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An all-in-one Cas9/gRNA expression construct by cloning an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene #129727) downstream of the hU6 promoter in a PX458 (Addgene #48138 ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... These Level 0 promoter parts were used in in one-step digestion-ligation reactions with the Level 1 Loop pCk1 (Addgene #136695) backbones together with parts containing LucN (pEPYC0CM0133 ...
-
bioRxiv - Neuroscience 2023Quote: The all-in-one gRNA-Cas9 expression plasmid used for CRISPRa was generated by modifying the hUBC-dSpCas9-2xVP64-T2A-BSD plasmid (Addgene #162333) to remove the T2A-BSD selection marker and include a U6-gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... Each of the following plasmids (15 µg) was added to one 15-cm dish: ASCL1 (TetO-ASCL1-puro, Addgene plasmid # 97329), DXL2 (TetO-DXL2-hygro ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Neuroscience 2024Quote: ... Pulled injection pipettes were beveled and back-filled with mineral oil before being loaded with one or more of the following: AAV1-Syn-ChrimsonR-tdTomato (Chrimson, 2.10e+13 gc/mL, 250 nL, Addgene #59171-AAV1), AAV5-Syn-FLEX-rc [ChrimsonR-tdTomato] (FLEX-Chrimson ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Genetics 2019Quote: We cloned Lamin A or Lamin C cDNAs with S22 and S392 mutations or without mutations into the all-in-one doxycycline inducible lentivirus vector pCW57-MCS1-P2A-MCS2-PGK-Blast (gift from Adam Karpf; Addgene plasmid #80921) (Barger et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All other sgRNAs were cloned into plasmid pEJS654 All-in-One AAV-sgRNA-hNmeCas9 (kind gift from Erik Sontheimer, Addgene plasmid #112139) via the SapI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmid (TLCV2-ApaLI(*)-T2A-mTagBFP2-Puro) used in all other figures were cloned using the all-in-one Dox-inducible lentiviral backbone of TLCV2 (Addgene Plasmid #97360) by inserting mito-ApaLI(* ...
-
bioRxiv - Biochemistry 2023Quote: ... fluorophore labelled ‘601’ DNA was generated using large-scale PCR with Phusion polymerase (produced in-house) from a pGEM- 3z/601 plasmid containing one copy of ‘601’ DNA (gift from J. Widom, Addgene plasmid #26656)(Lowary & Widom ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: MEFs were transfected with 4 μg of 8xGTIIC-luciferase (Addgene, #34615), SBE2-luciferase (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...